si:dkey-71b5.7

Ensembl ID:
ENSDARG00000080675
ZFIN ID:
ZDB-GENE-100922-124
Human Orthologue:
OTOA
Human Description:
otoancorin [Source:HGNC Symbol;Acc:16378]
Mouse Orthologue:
Otoa
Mouse Description:
otoancorin Gene [Source:MGI Symbol;Acc:MGI:2149209]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7423 Missense Mutation detected in F1 DNA During 2018
sa45573 Essential Splice Site Mutation detected in F1 DNA During 2018
sa17950 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa7423
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000116114 Missense 695 1151 17 26
ENSDART00000145100 Missense 166 405 5 10
Genomic Location (Zv9):
Chromosome 16 (position 24149753)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 22154247
GRCz11 16 21958499
KASP Assay ID:
554-4078.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCTTTGGTGTGTGAATTAGACCCGGTYTGGATCTCCTCTCTGAACCCTG[C/A]AGCTCGCAACGCCACCCTGAAGTCTCTGGCATCCTGTCAGTACATCCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45573
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000116114 Essential Splice Site 925 1151 21 26
ENSDART00000145100 Essential Splice Site 396 405 9 10
Genomic Location (Zv9):
Chromosome 16 (position 24146051)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 22150545
GRCz11 16 21954797
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCTGGACACATTGGAGATACTGGCCAACTGTAACTTTACACAGACACAG[G/A]TAATTCAAGCATAAATACATTCAGTCAATATCTTTAAAAAAAAAAAAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17950
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000116114 Essential Splice Site 1019 1151 23 26
ENSDART00000145100   None 405 None 10
Genomic Location (Zv9):
Chromosome 16 (position 24144338)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 22148832
GRCz11 16 21953084
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAGAAAACTGGACTGAAGCTCAGATCTGCATAATGGGGAACATCATTGG[T/A]GAGGAAATTTACCAGTGGATTACGCTTAAATACTTACATGTTGAAGTTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link