LOC100330644

Ensembl ID:
ENSDARG00000079999
Human Orthologue:
RSBN1
Human Description:
round spermatid basic protein 1 [Source:HGNC Symbol;Acc:25642]
Mouse Orthologue:
Rsbn1
Mouse Description:
rosbin, round spermatid basic protein 1 Gene [Source:MGI Symbol;Acc:MGI:2444993]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45860 Nonsense Mutation detected in F1 DNA During 2018
sa30473 Nonsense Mutation detected in F1 DNA During 2018
sa39519 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45860
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111538 Nonsense 196 624 1 6
Genomic Location (Zv9):
Chromosome Zv9_NA661 (position 2844)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAAGCCCCTCAACAACAAGCCCAAACACATCGAGAAGGACGCCAAACTT[A/T]AGCCCAAGAAGGAAAACGCCGAGGCTAACGTCAAAGTGGGGGAGTGCAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30473
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111538 Nonsense 261 624 2 6
Genomic Location (Zv9):
Chromosome Zv9_NA661 (position 4480)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 26299408
GRCz11 23 26225949
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCGTGGCAAGAAGTTACGAATGCACCATAAGGAGGTCCAGACGGTGTG[T/A]TCAGGAGACACTCCACCGCTTTCTGAAGACCCTGTGGGACATGCGTACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39519
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111538 Nonsense 386 624 2 6
Genomic Location (Zv9):
Chromosome Zv9_NA661 (position 4854)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 26299034
GRCz11 23 26225575
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTACGCGCTCGCTGTGGTGCATGGAGCAGCTGCATACCTGCCCGACTTCT[T/A]GGACTATTTTGCCTTCAATTTCCCAAACACACCTGTCAAGGTGGAAATCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link