
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ENSDARG00000079994
- Ensembl ID:
- ENSDARG00000079994
Alleles
There are 5 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa16339 | Essential Splice Site | Available for shipment | Available now |
sa17891 | Nonsense | Available for shipment | Available now |
sa12723 | Nonsense | Available for shipment | Available now |
sa24619 | Essential Splice Site | Available for shipment | Available now |
sa17381 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa16339
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000112789 | Essential Splice Site | 63 | 1666 | 2 | 21 |
- Genomic Location (Zv9):
- Chromosome 25 (position 11542387)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 11078940 GRCz11 25 11175736 - KASP Assay ID:
- 2261-9441.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TCYAGCACACTRAAGATCAGCCATGTCACGCTGCAGGCCGTCTGTCCAGG[T/G]CAGAAAATATCAWTAACTGTATAGTTACAGTACAAAAATTGTATGTACAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa17891
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000112789 | Nonsense | 549 | 1666 | 6 | 21 |
- Genomic Location (Zv9):
- Chromosome 25 (position 11577794)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 11114347 GRCz11 25 11211143 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGAGCCCCAGTTGCCTACACAATGCYYAGAGGGAACAGATGAAGCTAART[T/A]GACTTTAATTCAGGTAAATTCTGAAGTTAYTTTGTCTRTACKAAGCGAGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa12723
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000112789 | Nonsense | 1193 | 1666 | 10 | 21 |
- Genomic Location (Zv9):
- Chromosome 25 (position 11618283)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 11154836 GRCz11 25 11251632 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ACAGGCTGAGGACAGCATTACCATCACCAGTGGCGTGTCCATGTCCTATT[C/A]GTCCTCCACAGATGACTCTTCCAGCTTGGGAACCMCTTGCGCCACCCCTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa24619
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000112789 | Essential Splice Site | 1416 | 1666 | 14 | 21 |
- Genomic Location (Zv9):
- Chromosome 25 (position 11629646)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 11165469 GRCz11 25 11262265 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTCACCAAATCTGTGTCCATGGTGGCCATCAGTCAGAAGGACCTGGACGG[T/C]GAGTTGAAATCATCTTCTCTGTTTTTCTGTCCTCCGTCTTGTTGTGTCTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa17381
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000112789 | Essential Splice Site | 1610 | 1666 | 20 | 21 |
- Genomic Location (Zv9):
- Chromosome 25 (position 11646026)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 11181837 GRCz11 25 11278633 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ACTGTTACAGATTCTGCCTCGACGCCTAGTGTCAYCCTCAGAAGTAAAAG[T/A]AAGTTTCCCTYATACTCATTTGATGTATTCTTCTCTATTTGCATGTKTYA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: