zte25

Ensembl ID:
ENSDARG00000079983
ZFIN ID:
ZDB-GENE-070719-6
Description:
cytosolic carboxypeptidase 2 [Source:RefSeq peptide;Acc:NP_001092717]
Human Orthologue:
AGBL2
Human Description:
ATP/GTP binding protein-like 2 [Source:HGNC Symbol;Acc:26296]
Mouse Orthologue:
Agbl2
Mouse Description:
ATP/GTP binding protein-like 2 Gene [Source:MGI Symbol;Acc:MGI:2443254]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13465 Nonsense Available for shipment Available now
sa44328 Essential Splice Site Mutation detected in F1 DNA During 2018
sa6806 Nonsense Mutation detected in F1 DNA During 2018
sa10896 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13465
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114662 Nonsense 128 721 4 19
ENSDART00000135247 Nonsense 128 199 4 6
ENSDART00000137677   None 96 None 4
ENSDART00000138918 Nonsense 129 1025 4 24
ENSDART00000138980   None 148 None 4
Genomic Location (Zv9):
Chromosome 25 (position 29501644)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 28191738
GRCz11 25 28634940
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTGTCCGTTCCAGGGCGTCCGCTGGCCCATAGAGTGTGATGTGATCTG[T/A]GACAAAATCCAGCATATCGGTATTAAKRCTTTTCTTCTATTATTAATGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44328
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114662 Essential Splice Site 134 721 4 19
ENSDART00000135247 Essential Splice Site 134 199 4 6
ENSDART00000137677   None 96 None 4
ENSDART00000138918 Essential Splice Site 135 1025 4 24
ENSDART00000138980   None 148 None 4
Genomic Location (Zv9):
Chromosome 25 (position 29501624)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 28191718
GRCz11 25 28634920
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGCTGGCCCATAGAGTGTGATGTGATCTGTGACAAAATCCAGCATATCG[G/T]TATTAAGGCTTTTCTTCTATTATTAATGCAGTATATTGTTAAATTTGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6806
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114662 Nonsense 516 721 10 19
ENSDART00000135247   None 199 None 6
ENSDART00000137677   None 96 None 4
ENSDART00000138918 Nonsense 517 1025 10 24
ENSDART00000138980   None 148 None 4
Genomic Location (Zv9):
Chromosome 25 (position 29486163)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 28176257
GRCz11 25 28619459
KASP Assay ID:
554-5222.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGAAAAACAATGTGTTCATGTATGGATGCAATGAACGGAAAGATGCCT[C/A]GCAGTGTCTTCAAGAACGTGTTTTCCCACTGATGATGAGCAAGAACGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10896
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114662 Nonsense 690 721 15 19
ENSDART00000135247   None 199 None 6
ENSDART00000137677   None 96 None 4
ENSDART00000138918 Nonsense 691 1025 15 24
ENSDART00000138980   None 148 None 4
Genomic Location (Zv9):
Chromosome 25 (position 29483682)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 28173776
GRCz11 25 28616978
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAAAAGCTCCTGAGAAGCCGTAAAGAAAGAAACAGACTCCGGCAAGGA[C/T]GAGTACAGAGCGCAGGACCCAAAATCTTTCAAAGGAACATCAAACATTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link