zgc:171801

Ensembl ID:
ENSDARG00000079946
ZFIN ID:
ZDB-GENE-071004-98
Description:
squalene monooxygenase [Source:RefSeq peptide;Acc:NP_001103509]
Human Orthologue:
SQLE
Human Description:
squalene epoxidase [Source:HGNC Symbol;Acc:11279]
Mouse Orthologue:
Sqle
Mouse Description:
squalene epoxidase Gene [Source:MGI Symbol;Acc:MGI:109296]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14511 Nonsense Available for shipment Available now
sa18371 Nonsense Available for shipment Available now
sa22933 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14511
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110994 Nonsense 148 557 2 11
Genomic Location (Zv9):
Chromosome 16 (position 46202298)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 43500058
GRCz11 16 43403800
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCGGGTCACCGTGGTGGAGAGGGACATGAAAGAACCAGACCGAATAGTT[G/T]GAGAACTTCTGCAGCYGGGAGGATTTCGKGTACTCAAAGACCTTGGCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18371
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110994 Nonsense 197 557 3 11
Genomic Location (Zv9):
Chromosome 16 (position 46201983)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 43500373
GRCz11 16 43404115
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAATCCATGACATGGAAAGTAGGACAGAGGTGGAGATCCCATATCCCCAG[C/T]AGGAGAACTGCATTCAGGRTGGACGTGCTTTCCATCATGGGCGCTTCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22933
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110994 Essential Splice Site 295 557 5 11
Genomic Location (Zv9):
Chromosome 16 (position 46201167)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 43501189
GRCz11 16 43404931
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCTGGGAAAGTTCGGGTGTCGTCGCATTTTGTTGGATGCATAATGAAG[G/A]TAAACATAAGGAGGACAGATGTACTGTTGTAGATGTGAAGTAATACAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link