
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
jmjd1c
- Ensembl ID:
- ENSDARG00000079939
- Human Orthologue:
- JMJD1C
- Human Description:
- jumonji domain containing 1C [Source:HGNC Symbol;Acc:12313]
- Mouse Orthologue:
- Jmjd1c
- Mouse Description:
- jumonji domain containing 1C Gene [Source:MGI Symbol;Acc:MGI:1918614]
Alleles
There are 5 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa18109 | Nonsense | Available for shipment | Available now |
sa15925 | Nonsense | Available for shipment | Available now |
sa11812 | Nonsense | Available for shipment | Available now |
sa22034 | Nonsense | Available for shipment | Available now |
sa6235 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa18109
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000113148 | Nonsense | 1110 | 2557 | 11 | 27 |
- Genomic Location (Zv9):
- Chromosome 12 (position 9378589)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 8586544 GRCz11 12 8624387 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CAGCCCAAAAGCCACGAGAAAGAGACAGAGMACTCTATGGCTGATCTGTA[C/A]AAGTACAAAMAYTCWGTATCTCAGTCTCTCCCTCAAACCAACTACTTTAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa15925
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000113148 | Nonsense | 1560 | 2557 | 11 | 27 |
- Genomic Location (Zv9):
- Chromosome 12 (position 9377241)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 8585196 GRCz11 12 8623039 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ATTMCACGCCCAGCAATCCWCYCAGCAAAGCCAGCCCGTTGCCCAATGGA[C/T]AGGCAGCGCAGGTGTGCCAGTCTAACYACCACAAACTCAAGAAAGCCTGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa11812
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000113148 | Nonsense | 1677 | 2557 | 11 | 27 |
- Genomic Location (Zv9):
- Chromosome 12 (position 9376890)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 8584845 GRCz11 12 8622688 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGCTGGAGCAAAGGACTAARCGGCAACCCAAGCCCACTTACAAAAARAAG[C/T]AGAACGACATGCAGAAAAGGAAGGGAGACAATGAGAAGGAGGAGGACGAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa22034
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000113148 | Nonsense | 1911 | 2557 | 15 | 27 |
- Genomic Location (Zv9):
- Chromosome 12 (position 9366316)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 8574271 GRCz11 12 8612114 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGTGTGTAATCCACCTTTTCTTATTCCGCAGATAAAGAGCTGTACGCCTG[G/A]TTGAAGTGTGTCAAGGGACAGCCTCATGATCACAAGCACCTGATGCCAAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa6235
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000113148 | Nonsense | 2222 | 2557 | 20 | 27 |
- Genomic Location (Zv9):
- Chromosome 12 (position 9349641)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 8557596 GRCz11 12 8595439 - KASP Assay ID:
- 554-4711.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTTGTAGCCTGTACTAGTCTCTGGGGTGCACCGAAGGCTCAACGCCAGCT[T/A]GTGGAAAGCAGAGTCCTTCAACCAAGAGTTTGCTGACCACCAGGGGGACC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Androgen levels: Genome-wide association study identifies a new locus JMJD1C at 10q21 that may influence serum androgen levels in men. (View Study)
- Arthritis (juvenile idiopathic): Genome-wide association analysis of juvenile idiopathic arthritis identifies a new susceptibility locus at chromosomal region 3q13. (View Study)
- Liver enzyme levels: Population-based genome-wide association studies reveal six loci influencing plasma levels of liver enzymes. (View Study)
- Liver enzyme levels (gamma-glutamyl transferase): Genome-wide association study identifies loci influencing concentrations of liver enzymes in plasma. (View Study)
- Mean platelet volume: A genome-wide meta-analysis identifies 22 loci associated with eight hematological parameters in the HaemGen consortium. (View Study)
- Mean platelet volume: A meta-analysis and genome-wide association study of platelet count and mean platelet volume in african americans. (View Study)
- Platelet aggregation: Genome-wide meta-analyses identifies seven loci associated with platelet aggregation in response to agonists. (View Study)
- Platelet counts: GWAS of blood cell traits identifies novel associated loci and epistatic interactions in Caucasian and African-American children. (View Study)
- Platelet counts: New gene functions in megakaryopoiesis and platelet formation. (View Study)
- Sex hormone-binding globulin levels: A genome-wide association meta-analysis of circulating sex hormone-binding globulin reveals multiple Loci implicated in sex steroid hormone regulation. (View Study)
- Triglycerides: Biological, clinical and population relevance of 95 loci for blood lipids. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: