zgc:162200

Ensembl ID:
ENSDARG00000079934
ZFIN ID:
ZDB-GENE-030131-2989
Description:
bicaudal D homolog 2-like [Source:RefSeq peptide;Acc:NP_001077017]
Human Orthologues:
BICD1, BICD2
Human Descriptions:
bicaudal D homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:1049]
bicaudal D homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:17208]
Mouse Orthologues:
Bicd1, Bicd2
Mouse Descriptions:
bicaudal D homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1101760]
bicaudal D homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1924145]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2430 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa2430
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004041 Nonsense 146 852 3 10
Genomic Location (Zv9):
Chromosome 8 (position 38205189)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 37060604
GRCz11 8 37093038
KASP Assay ID:
554-2879.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTGAACAATACCTCGGCTGAAAACGAGAGACTGGTCAGCCTTTCCACA[C/T]AGATGAAAAAGGTACGTTTAATGTCATYAATGAGTAAGCCCAGGGTCTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link