NP_001106955.1

Ensembl ID:
ENSDARG00000079922
Description:
Krueppel-like factor 4 [Source:RefSeq peptide;Acc:NP_001106955]
Human Orthologue:
KLF4
Human Description:
Kruppel-like factor 4 (gut) [Source:HGNC Symbol;Acc:6348]
Mouse Orthologue:
Klf4
Mouse Description:
Kruppel-like factor 4 (gut) Gene [Source:MGI Symbol;Acc:MGI:1342287]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45723 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45723
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110297 Essential Splice Site 2 352 2 4
Genomic Location (Zv9):
Chromosome 21 (position 627384)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 485597
GRCz11 21 435148
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTTTTATTATTATTATTATTTTATTTTTTTATTTATTTGTTAAATTTC[A/C]GGCAGCCTCCGACTGAGTTTGATAGCATGGCACTGAGCGGAACGATTTTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Breast cancer: Novel breast cancer susceptibility locus at 9q31.2: results of a genome-wide association study. (View Study)
  • Prostate cancer: Genome-wide association study in Chinese men identifies two new prostate cancer risk loci at 9q31.2 and 19q13.4. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link