zgc:175136

Ensembl ID:
ENSDARG00000079916
ZFIN ID:
ZDB-GENE-080204-122
Description:
hypothetical protein LOC100136863 [Source:RefSeq peptide;Acc:NP_001108053]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36860 Nonsense Mutation detected in F1 DNA During 2018
sa18165 Nonsense Available for shipment Available now
sa8695 Nonsense Mutation detected in F1 DNA During 2018
sa23546 Nonsense Available for shipment Available now
sa9270 Nonsense Mutation detected in F1 DNA During 2018
sa3009 Nonsense F2 line generated During 2018
sa29226 Missense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa36860
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109429 Nonsense 20 599 3 5
ENSDART00000132237 Nonsense 47 626 3 5

The following transcripts of ENSDARG00000079916 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 30560885)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 14247511
GRCz11 19 14109706
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGTGATGTTCAAAGATTTTTAACACCTACCTTACCAGTGATTGGTTCT[G/T]AGGTGAAACAAAAGGCAATTTGGAATGAACTTTCCTATGGTTCTGTTCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18165
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109429 Nonsense 131 599 3 5
ENSDART00000132237 Nonsense 158 626 3 5

The following transcripts of ENSDARG00000079916 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 30561218)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 14247844
GRCz11 19 14110039
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGTTGGTAGCCGACTTGCTTCAGCCTTGTCTCAAAGTGGGCCCACATTG[A/T]GAAAAACCTWRAAAGTACCTGAATTGAGTAGTTTAAAAATMTCTAGAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8695
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109429 Nonsense 134 599 3 5
ENSDART00000132237 Nonsense 161 626 3 5

The following transcripts of ENSDARG00000079916 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 30561228)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 14247854
GRCz11 19 14110049
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGACTTGCTTCAGCCTTGTCTCAAAGTGGGCCCACATTGAGAAAAACCT[T/A]RAAAGTACCTGAATTGAGTAGTTTAAAAATMTCTAGAGGTGAATCTAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23546
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109429 Nonsense 228 599 3 5
ENSDART00000132237 Nonsense 255 626 3 5

The following transcripts of ENSDARG00000079916 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 30561511)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 14248137
GRCz11 19 14110332
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTTTCCAGATTATGGAAAACCGCCTGTTCATAGACTCATTAAACCCTA[C/A]AAGGGCAGTCAGACCTCTAGAGATGGTAGCTTGTCTGCTAGCAGTCTGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9270
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109429 Nonsense 239 599 3 5
ENSDART00000132237 Nonsense 266 626 3 5

The following transcripts of ENSDARG00000079916 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 30561543)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 14248169
GRCz11 19 14110364
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGACTCATTAAACCCTACAAGGGCAGTCAGACCTCTAGAGATGGTAGCT[T/A]GTCTGCTAGCAGTCTGGGAAAGGCATGGAAAAAGACACTTCAATACTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3009
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109429 Nonsense 322 599 3 5
ENSDART00000132237 Nonsense 349 626 3 5

The following transcripts of ENSDARG00000079916 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 30561791)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 14248417
GRCz11 19 14110612
KASP Assay ID:
554-2644.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTATGAAGCAACTATTCCCAAATTTCAGCAAGTTCACAACAGTCGTGGA[C/T]AATCAAATCAAATGTTTAAACCCATGTACCCCCCTCAAAATGGGGCTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29226
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109429 Missense 488 599 3 5
ENSDART00000132237 Missense 515 626 3 5

The following transcripts of ENSDARG00000079916 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 30562290)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 14248916
GRCz11 19 14111111
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCTTTGGTCAAGTACAGAGCCAAAGGGCTTCTGGTGACATTAGCAGAG[G/A]TGCTTATCAAAGTTCCTTACCTTCCAGTTACATGGGTCTAATGCCTAGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link