cacnb2a

Ensembl ID:
ENSDARG00000079906
ZFIN IDs:
ZDB-GENE-080808-7, ZDB-GENE-080808-7, ZDB-GENE-080808-7, ZDB-GENE-080808-7, ZDB-GENE-080808-7
Description:
voltage-dependent L-type calcium channel subunit beta-2 [Source:RefSeq peptide;Acc:NP_001077037]
Human Orthologue:
CACNB2
Human Description:
calcium channel, voltage-dependent, beta 2 subunit [Source:HGNC Symbol;Acc:1402]
Mouse Orthologue:
Cacnb2
Mouse Description:
calcium channel, voltage-dependent, beta 2 subunit Gene [Source:MGI Symbol;Acc:MGI:894644]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45305 Missense, Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45305
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Missense, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103725   None 214 8 14
ENSDART00000111504 Missense 191 598 7 13
ENSDART00000112679 Nonsense 235 238 8 14
ENSDART00000113991 Missense 229 636 7 13
ENSDART00000114071 Missense 218 625 7 13
ENSDART00000130272 Missense 191 562 7 16
Genomic Location (Zv9):
Chromosome 7 (position 74474857)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 71620247
GRCz11 7 71812039
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTTTGTGTGCCGCTGTACAGACGGAGCATGCTCCTCCATATGATGTG[G/A]TGCCGTCGATGAGGCCGGTTGTTCTCGTTGGACCTTCACTCAAGGGCTAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link