si:dkey-48m5.3

Ensembl ID:
ENSDARG00000079895
ZFIN ID:
ZDB-GENE-091204-238
Human Orthologue:
EHBP1L1
Human Description:
EH domain binding protein 1-like 1 [Source:HGNC Symbol;Acc:30682]
Mouse Orthologue:
Ehbp1l1
Mouse Description:
EH domain binding protein 1-like 1 Gene [Source:MGI Symbol;Acc:MGI:3612340]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10687 Essential Splice Site Available for shipment Available now
sa41675 Nonsense Mutation detected in F1 DNA During 2018
sa45408 Nonsense Mutation detected in F1 DNA During 2018
sa44726 Nonsense Mutation detected in F1 DNA During 2018
sa27622 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa10687
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089205 Essential Splice Site 86 2382 3 30
ENSDART00000137657   None 568 None 12
ENSDART00000139226 Essential Splice Site 86 195 3 6
Genomic Location (Zv9):
Chromosome 10 (position 27521612)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 26924406
GRCz11 10 26886119
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTTTGGCCCGTTCCCGAGAATGTGGACATTACAGTCACACTCTACAGGG[T/C]AGGACATATTAATATAATGCATTAATCCATGCCATATGCAACATGTTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41675
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089205 Nonsense 990 2382 16 30
ENSDART00000137657   None 568 None 12
ENSDART00000139226   None 195 None 6
Genomic Location (Zv9):
Chromosome 10 (position 27537477)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 26940271
GRCz11 10 26901984
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTATTTTAAGTGAACCAGTGTCCCAGCAGCCACTACCCTCCATTGTCCTT[A/T]AACCACAGCCATCTGAGTCTGTTAAGGAAAAGAAAATAGAAGCTGTTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45408
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089205 Nonsense 1061 2382 16 30
ENSDART00000137657   None 568 None 12
ENSDART00000139226   None 195 None 6
Genomic Location (Zv9):
Chromosome 10 (position 27537690)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 26940484
GRCz11 10 26902197
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCCCAACCAGTCTCTGGATACAGAGTCCTACGGAAATAGTTTAAGGAAA[A/T]AGGTCACGTTTGAAGCAGAAAGTGTGTTGTGGGCCACAGTAGAGGAGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44726
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089205 Nonsense 1070 2382 16 30
ENSDART00000137657   None 568 None 12
ENSDART00000139226   None 195 None 6
Genomic Location (Zv9):
Chromosome 10 (position 27537718)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 26940512
GRCz11 10 26902225
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTACGGAAATAGTTTAAGGAAAAAGGTCACGTTTGAAGCAGAAAGTGTGT[T/A]GTGGGCCACAGTAGAGGAGAAAACAAAAGAAAACAGTGATGAGGGTGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27622
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089205 Nonsense 1172 2382 17 30
ENSDART00000137657   None 568 None 12
ENSDART00000139226   None 195 None 6
Genomic Location (Zv9):
Chromosome 10 (position 27538909)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 26941703
GRCz11 10 26903416
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCACAACTCAAGATGAACTTGAAGATGACCTGAAGTCTGTAGATGTGTG[T/A]TCAGAGACCCAACTCAGCCATGACCTGGATGTGAAAACTGACAAGTACCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link