
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ENSDARG00000079894
- Ensembl ID:
- ENSDARG00000079894
- Human Orthologues:
- GNRHR, GNRHR2
- Human Descriptions:
- gonadotropin-releasing hormone (type 2) receptor 2 [Source:HGNC Symbol;Acc:16341]
- gonadotropin-releasing hormone receptor [Source:HGNC Symbol;Acc:4421]
- Mouse Orthologue:
- Gnrhr
- Mouse Description:
- gonadotropin releasing hormone receptor Gene [Source:MGI Symbol;Acc:MGI:95790]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa42836 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa42836
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000111727 | Essential Splice Site | 155 | 334 | 15 | 16 |
- Genomic Location (Zv9):
- Chromosome 16 (position 58113241)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 54515275 GRCz11 16 54696607 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAGTAATATTTACCTCCTCTTCTCGCTCATATATGATGGTTTTGTTGATG[G/A]TGCAGCTGTTCATCTTCCATACGGTGAAAGCGAAGAGTGTGGACTTCACG
- Associated Phenotype:
- Not determined
OMIM
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: