
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-244c8.3
- Ensembl ID:
- ENSDARG00000079889
- ZFIN ID:
- ZDB-GENE-091118-9
- Human Orthologue:
- PHLDB2
- Human Description:
- pleckstrin homology-like domain, family B, member 2 [Source:HGNC Symbol;Acc:29573]
- Mouse Orthologue:
- Phldb2
- Mouse Description:
- pleckstrin homology-like domain, family B, member 2 Gene [Source:MGI Symbol;Acc:MGI:2444981]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa16842 | Nonsense | Available for shipment | Available now |
sa24883 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa16842
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000109705 | Nonsense | 106 | 1026 | 2 | 16 |
ENSDART00000131984 | Nonsense | 189 | 1197 | 3 | 18 |
- Genomic Location (Zv9):
- Chromosome 10 (position 36515783)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 35548485 GRCz11 10 35492345 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TCCACCACTTTCAATACGAGTCCCTTCCCCTTACTCACCCTCCAGTAGTT[T/A]GAGCATGCCGCCATCTCCCCACCAATCAGAGCGCCCTATAAGTCCAGTCC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa24883
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000109705 | Essential Splice Site | 878 | 1026 | 13 | 16 |
ENSDART00000131984 | Essential Splice Site | 1029 | 1197 | 15 | 18 |
- Genomic Location (Zv9):
- Chromosome 10 (position 36544311)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 35577013 GRCz11 10 35520873 - KASP Assay ID:
- 554-7476.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GAAGACTGCAGGAGGAGACCAGCAGAAGACAGAAACTAGTGGAGAGAGAG[G/A]TGAAGATACCAGACTAACCTGTTTATAGTTGCTCTAATTCAAACATTTTA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Cognitive performance: Common genetic variation and performance on standardized cognitive tests. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: