wu:fc69a03

Ensembl ID:
ENSDARG00000079886
ZFIN IDs:
ZDB-GENE-030131-4084, ZDB-GENE-030131-4084, ZDB-GENE-030131-4084, ZDB-GENE-030131-4084, ZDB-GENE-070912-627
Description:
wu:fc69a03 [Source:RefSeq peptide;Acc:NP_001159487]
Human Orthologue:
FAM105B
Human Description:
family with sequence similarity 105, member B [Source:HGNC Symbol;Acc:25118]
Mouse Orthologue:
Fam105b
Mouse Description:
family with sequence similarity 105, member B Gene [Source:MGI Symbol;Acc:MGI:3577015]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7501 Missense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa7501
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112605 Missense 184 409 5 8
ENSDART00000137921   None 177 None 6
ENSDART00000138684 Missense 184 258 6 8
ENSDART00000146758 Missense 184 409 6 9

The following transcripts of ENSDARG00000079886 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 31662937)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 31961844
GRCz11 2 31945062
KASP Assay ID:
554-4007.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTGCTCTAAGGGCGACGCTTTTCCAGGTGCTGAGTCAGTCCAAAAAGC[T/A]TCCTGCCTGGTTACAGGACTCTGACATTGTTAAGGTAATTTAGCCTTATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link