
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
tas2r200.1
- Ensembl ID:
- ENSDARG00000079880
- ZFIN ID:
- ZDB-GENE-070917-4
- Description:
- taste receptor, type 2, member 200.1 [Source:RefSeq peptide;Acc:NP_001034919]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa34435 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa21331 | Nonsense | Available for shipment | Available now |
sa17069 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa34435
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000112981 | Nonsense | 231 | 320 | 1 | 1 |
- Genomic Location (Zv9):
- Chromosome 8 (position 31632754)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 30775480 GRCz11 8 30784712 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACACGGGCACTCCAGAAGAACCAGACGCAGGTGCAGGGATCCGACTCGTA[T/A]CTCTTGGTGTGCAAACTCACCATCTCTCTGGTGGGAGTTTATCTGTCCAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa21331
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000112981 | Nonsense | 245 | 320 | 1 | 1 |
- Genomic Location (Zv9):
- Chromosome 8 (position 31632796)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 30775522 GRCz11 8 30784754 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GACTCGTATCTCTTGGTGTGCAAACTCACCATCTCTCTGGTGGGAGTTTA[T/A]CTGTCCACTCTATTTATGGTGGCATTGTATTTCATTATAAAGGTTTTGGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa17069
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000112981 | Nonsense | 295 | 320 | 1 | 1 |
- Genomic Location (Zv9):
- Chromosome 8 (position 31632944)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 30775670 GRCz11 8 30784902 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GTGGAATGACTTCAGTGCTRCTGACGGCATCAAACAGGTATCTGAAAGAY[A/T]AACTTTGGAGTCTGTTCTGTTGCAGGAAAGCAAAGGAGCCAGTTAGCAAA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: