
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
arid1aa
- Ensembl ID:
- ENSDARG00000079879
- ZFIN ID:
- ZDB-GENE-080220-35
- Human Orthologue:
- ARID1A
- Human Description:
- AT rich interactive domain 1A (SWI-like) [Source:HGNC Symbol;Acc:11110]
- Mouse Orthologue:
- Arid1a
- Mouse Description:
- AT rich interactive domain 1A (SWI-like) Gene [Source:MGI Symbol;Acc:MGI:1935147]
Alleles
There are 8 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa6439 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa28698 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa31006 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa10989 | Nonsense | Available for shipment | Available now |
sa10925 | Nonsense | Available for shipment | Available now |
sa22893 | Nonsense | Available for shipment | Available now |
sa22894 | Nonsense | Available for shipment | Available now |
sa9394 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa6439
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000084263 | Nonsense | 358 | 2285 | 2 | 20 |
ENSDART00000135930 | None | 1788 | None | 18 |
The following transcripts of ENSDARG00000079879 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 16 (position 36381009)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 34010792 GRCz11 16 33964822 - KASP Assay ID:
- 554-4129.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CAGGCCAGGGTTATGGKCCCCCTGGCCCTCAGAGATACCCTATGGGCATG[C/T]AAGGACGGATGCAGTACGGCCAGCAGGTCAGTGCTCTTTTTATTTAAGGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa28698
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000084263 | Nonsense | 463 | 2285 | 3 | 20 |
ENSDART00000135930 | None | 1788 | None | 18 |
The following transcripts of ENSDARG00000079879 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 16 (position 36388406)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 34018189 GRCz11 16 33972219 - KASP Assay ID:
- 2261-0028.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCAGGGGCAGATGACTGGTCCCTCGCCGGGCCCTTCCCAGTCCCCATACT[C/A]GCAGTCGTCGGCAGCAGCAGCAGCAGCAGCACCCCAGTCTAGCCAGTCTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa31006
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000084263 | Essential Splice Site | 885 | 2285 | 8 | 20 |
ENSDART00000135930 | Essential Splice Site | 387 | 1788 | 6 | 18 |
The following transcripts of ENSDARG00000079879 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 16 (position 36396146)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 34025929 GRCz11 16 33979959 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAGGATGCTGGAGCAATGCAGCACGGTCCAACCAACTCGATACACAACAG[G/A]TACAGAAGAGCTTAAATTCAACATATGATTGAGTATTGATCTAAAATGGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa10989
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000084263 | Nonsense | 1327 | 2285 | 18 | 20 |
ENSDART00000135930 | Nonsense | 830 | 1788 | 16 | 18 |
ENSDART00000084263 | Nonsense | 1327 | 2285 | 18 | 20 |
ENSDART00000135930 | Nonsense | 830 | 1788 | 16 | 18 |
The following transcripts of ENSDARG00000079879 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 16 (position 36398614)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 34028397 GRCz11 16 33982427 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TATTATTTGCATTGGTTAATCTTTTTTTTTTTTTTTTTAATTCAGAACTA[C/A]AAAAGGCCAGGTGATGGCAGCTATCCTCCAGCTAAACGGCATCATGATGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa10925
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000084263 | Nonsense | 1327 | 2285 | 18 | 20 |
ENSDART00000135930 | Nonsense | 830 | 1788 | 16 | 18 |
ENSDART00000084263 | Nonsense | 1327 | 2285 | 18 | 20 |
ENSDART00000135930 | Nonsense | 830 | 1788 | 16 | 18 |
The following transcripts of ENSDARG00000079879 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 16 (position 36398614)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 34028397 GRCz11 16 33982427 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TATTATTTGCATTGGTTAATCTTTTTTTTTTTTTTTTTAATTCAGAACTA[C/A]AAAAGGCCAGGTGATGGCAGCTATCCTCCAGCTAAACGGCATCATGATGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa22893
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000084263 | Nonsense | 1438 | 2285 | 18 | 20 |
ENSDART00000135930 | Nonsense | 941 | 1788 | 16 | 18 |
The following transcripts of ENSDARG00000079879 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 16 (position 36398947)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 34028730 GRCz11 16 33982760 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATGGGCAGTCAAATGCAGTCTGCTCCTGATGGTCCTCAAGGTGGTATGTG[G/A]CAGGGCCGAGGTGATATGGGCTACTCCAATTACCCCAATCGTCAGGGGCC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa22894
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000084263 | Nonsense | 1723 | 2285 | 20 | 20 |
ENSDART00000135930 | Nonsense | 1226 | 1788 | 18 | 18 |
The following transcripts of ENSDARG00000079879 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 16 (position 36399994)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 34029777 GRCz11 16 33983807 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGAAGATGGAGAAACTGAAGAGGAAGATGAAGGGGAAGAAGTGCAGAGGT[C/A]AAAACATCAAGAACAACATGCAGCACAAGTACCTCTCCAAATAAAACAGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa9394
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000084263 | Nonsense | 2209 | 2285 | 20 | 20 |
ENSDART00000135930 | Nonsense | 1712 | 1788 | 18 | 18 |
The following transcripts of ENSDARG00000079879 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 16 (position 36401451)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 34031234 GRCz11 16 33985264 - KASP Assay ID:
- 2261-0033.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TAGGGAATCTGTTGGGCTTCTTGGAGGACAGCTTAGCGGCTACACAGTTC[C/T]AGCAGAGCCAAGGTTCCTTACTTCACATGCAGGGGTCACACTTTGAGCCA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: