gmps

Ensembl ID:
ENSDARG00000079848
ZFIN ID:
ZDB-GENE-040426-1503
Description:
guanine monophosphate synthetase [Source:RefSeq peptide;Acc:NP_956881]
Human Orthologue:
GMPS
Human Description:
guanine monphosphate synthetase [Source:HGNC Symbol;Acc:4378]
Mouse Orthologue:
Gmps
Mouse Description:
guanine monophosphate synthetase Gene [Source:MGI Symbol;Acc:MGI:2448526]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44892 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44892
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109535 Nonsense 357 692 9 16
ENSDART00000130831   None 359 None 8

The following transcripts of ENSDARG00000079848 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 32423564)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 34220121
GRCz11 18 34196145
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGCGGTCTGTCATAGGTGGCGAATGAGGTGATTGGAGAGATGAATCTG[A/T]AGCCAGAGGATGTGTATCTGGCACAGGGAACGCTCAGGCCAGACCTCATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link