zgc:194578

Ensembl ID:
ENSDARG00000079847
ZFIN ID:
ZDB-GENE-081022-126
Description:
hypothetical protein LOC792915 [Source:RefSeq peptide;Acc:NP_001122248]
Human Orthologue:
EPN1
Human Description:
epsin 1 [Source:HGNC Symbol;Acc:21604]
Mouse Orthologue:
Epn1
Mouse Description:
epsin 1 Gene [Source:MGI Symbol;Acc:MGI:1333763]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23459 Essential Splice Site Available for shipment Available now
sa23458 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23459
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109488 Essential Splice Site 408 504 8 10
ENSDART00000127964 Essential Splice Site 408 639 6 9
Genomic Location (Zv9):
Chromosome 19 (position 11005586)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 10464125
GRCz11 19 10383050
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCGTTTGGCGATGCTTCAAAAGCAGATAATGACCCTTGGGGAACAGCAG[G/A]TGAGAATTAGACTGGATTGAAGGAAAAAGGCAGGTGCAGTACATCACATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23458
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109488 Nonsense 488 504 10 10
ENSDART00000127964 Nonsense 488 639 8 9
Genomic Location (Zv9):
Chromosome 19 (position 11002567)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 10461106
GRCz11 19 10380031
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCATTGGTGGACTTGGACTCTCTTATGTCAGTCAAGCCCAAACCCAAA[C/T]AGCCTCCTCTCAGCGCCATCCCAACCCAAAAAGCCCCTGGTAAGGAGGGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Major depressive disorder: Common genetic variation and antidepressant efficacy in major depressive disorder: a meta-analysis of three genome-wide pharmacogenetic studies. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link