
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-39f22.2
- Ensembl ID:
- ENSDARG00000079840
- ZFIN ID:
- ZDB-GENE-090313-115
- Description:
- calcium-activated potassium channel subunit alpha-1 [Source:RefSeq peptide;Acc:NP_001139072]
- Human Orthologue:
- KCNMA1
- Human Description:
- potassium large conductance calcium-activated channel, subfamily M, alpha member 1 [Source:HGNC Symb
- Mouse Orthologue:
- Kcnma1
- Mouse Description:
- potassium large conductance calcium-activated channel, subfamily M, alpha member 1 Gene [Source:MGI
Alleles
There are 6 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa15809 | Essential Splice Site | Available for shipment | Available now |
sa16902 | Nonsense | Available for shipment | Available now |
sa22259 | Essential Splice Site | Available for shipment | Available now |
sa11910 | Nonsense | Available for shipment | Available now |
sa35448 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa38929 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa15809
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000114192 | Essential Splice Site | 307 | 1029 | 10 | 26 |
ENSDART00000122557 | Essential Splice Site | 479 | 1229 | 13 | 30 |
ENSDART00000143200 | Essential Splice Site | 462 | 1184 | 13 | 29 |
The following transcripts of ENSDARG00000079840 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 13 (position 16849825)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 16669860 GRCz11 13 16800852 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTCAKRCTATTTTAAATTACCCATACTTTAATAGCTTTTCTCCTTTTTAC[A/T]GAGTGATATCTATCAAGAACTACCATCCAAAGATCAGAATAATAACAYAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa16902
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000114192 | Nonsense | 323 | 1029 | 10 | 26 |
ENSDART00000122557 | Nonsense | 495 | 1229 | 13 | 30 |
ENSDART00000143200 | Nonsense | 478 | 1184 | 13 | 29 |
The following transcripts of ENSDARG00000079840 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 13 (position 16849873)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 16669908 GRCz11 13 16800900 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ACWGAGTGATATCTATCAAGAACTACCATCCAAAGATCAGAATAATAACA[C/T]AAATGTTGCAGTACCACAACAAGGTAGGAGGTGTTTTTTGTTTTCAACAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa22259
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000114192 | Essential Splice Site | 419 | 1029 | 13 | 26 |
ENSDART00000122557 | Essential Splice Site | 591 | 1229 | 16 | 30 |
ENSDART00000143200 | Essential Splice Site | 574 | 1184 | 16 | 29 |
The following transcripts of ENSDARG00000079840 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 13 (position 16860128)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 16680163 GRCz11 13 16811155 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCTAGCTAAATGTTTTTCTTCTGTACACTTAATATATTTTTGCTTTTTTC[A/T]GGCTGTGCTACGTGAAGCTCAAGTTGCTGTTGATCGCTATTGAGTACAAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa11910
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000114192 | Nonsense | 626 | 1029 | 18 | 26 |
ENSDART00000122557 | Nonsense | 798 | 1229 | 21 | 30 |
ENSDART00000143200 | Nonsense | 781 | 1184 | 21 | 29 |
The following transcripts of ENSDARG00000079840 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 13 (position 16904489)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 16724524 GRCz11 13 16855516 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTCCATTACCATGAGCTAAAGCCCATTGTGTTTGTGGGCTCGTTAGATTA[T/A]CTGCGAAGAGAGTGGGAAACCCTTCACAACTTCCMCAAAGTCTTCATCTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa35448
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000114192 | Essential Splice Site | 644 | 1029 | 18 | 26 |
ENSDART00000122557 | Essential Splice Site | 816 | 1229 | 21 | 30 |
ENSDART00000143200 | Essential Splice Site | 799 | 1184 | 21 | 29 |
The following transcripts of ENSDARG00000079840 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 13 (position 16904545)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 16724580 GRCz11 13 16855572 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAGAGAGTGGGAAACCCTTCACAACTTCCCCAAAGTCTTCATCTTACCTG[T/G]GAGTGCATGCATTGAACAATGAGCTGTCTGTAAATATAATGCATTCATGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa38929
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000114192 | Nonsense | 983 | 1029 | 26 | 26 |
ENSDART00000122557 | Nonsense | 1183 | 1229 | 30 | 30 |
ENSDART00000143200 | Nonsense | 1138 | 1184 | 29 | 29 |
The following transcripts of ENSDARG00000079840 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 13 (position 16934680)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 16754715 GRCz11 13 16885707 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTCTCGTCTTCTACTTGTCTCCTGCCCTGGCTGTCTCCCAGAAAAGAGAT[G/A]GTTTACAGATGAAGCAGAAAACGCATACCCAAGGAACATTCAAATCAAGC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Bone mineral density: Genome-wide meta-analysis identifies 56 bone mineral density loci and reveals 14 loci associated with risk of fracture. (View Study)
- Mortality among heart failure patients: Genomic variation associated with mortality among adults of European and African ancestry with heart failure: the cohorts for heart and aging research in genomic epidemiology consortium. (View Study)
- Obesity: Genome wide association study identifies KCNMA1 contributing to human obesity. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: