arrdc1b

Ensembl ID:
ENSDARG00000079839
ZFIN ID:
ZDB-GENE-080515-2
Human Orthologue:
ARRDC1
Human Description:
arrestin domain containing 1 [Source:HGNC Symbol;Acc:28633]
Mouse Orthologue:
Arrdc1
Mouse Description:
arrestin domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2446136]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37260 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa37260
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114096 Essential Splice Site 77 443 2 8
Genomic Location (Zv9):
Chromosome 21 (position 12921638)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 14622812
GRCz11 21 14719541
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCTTGAGGAAAAGTACTTGAGCAGCACACTGTCTGTGGCAGATAAAGG[T/G]GAGGAGACCGACATCCATTCATCATCTCATTCAAATAAATAAACCTTTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link