
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:dkey-190g11.7
- Ensembl ID:
- ENSDARG00000079823
- ZFIN ID:
- ZDB-GENE-081104-343
- Description:
- hypothetical protein LOC567309 [Source:RefSeq peptide;Acc:NP_001107080]
- Human Orthologue:
- MRPS36
- Human Description:
- mitochondrial ribosomal protein S36 [Source:HGNC Symbol;Acc:16631]
- Mouse Orthologues:
- Mrps36, Mrps36-ps1
- Mouse Descriptions:
- mitichondrial ribosomal protein S36, pseudogene 1 Pseudogene [Source:MGI Symbol;Acc:MGI:3809201]
- mitochondrial ribosomal protein S36 Gene [Source:MGI Symbol;Acc:MGI:1913378]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa38679 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa38679
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000113821 | None | 113 | None | 4 | |
ENSDART00000135042 | Essential Splice Site | None | 113 | 2 | 5 |
ENSDART00000143920 | None | 113 | 2 | 5 |
- Genomic Location (Zv9):
- Chromosome 8 (position 17685979)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 17130867 GRCz11 8 17166579 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGCGCCCTCTAATGGTTACTAATGTATTTACTTTGTTTGAACCGGAAGCA[G/T]TGATCGGATGTCGTCATGGGAAGCAAAGTGAGTGGCAAGATGGCAGCTGC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: