si:dkey-259k14.1

Ensembl ID:
ENSDARG00000079812
ZFIN ID:
ZDB-GENE-090313-285
Human Orthologue:
ZMIZ2
Human Description:
zinc finger, MIZ-type containing 2 [Source:HGNC Symbol;Acc:22229]
Mouse Orthologue:
Zmiz2
Mouse Description:
zinc finger, MIZ-type containing 2 Gene [Source:MGI Symbol;Acc:MGI:106374]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7222 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa7222
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110166 Essential Splice Site 369 888 9 21
ENSDART00000131439   None 351 None 8
Genomic Location (Zv9):
Chromosome 10 (position 46034382)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 45476694
GRCz11 10 45323306
KASP Assay ID:
554-4610.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATACCCCAGTTCTCCTCTGCCTGGGAACCCCACSCCCCCCMTGACCCCC[G/C]GCAGCTCCATGCCCTACATGTCCCCCAATCAGGACGWCAAATCCCCATTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link