
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ENSDARG00000079791
- Ensembl ID:
- ENSDARG00000079791
- Human Orthologue:
- RASIP1
- Human Description:
- Ras interacting protein 1 [Source:HGNC Symbol;Acc:24716]
- Mouse Orthologue:
- Rasip1
- Mouse Description:
- Ras interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:1917153]
Alleles
There are 6 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa17863 | Nonsense | Available for shipment | Available now |
sa9151 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa19016 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa21990 | Missense | Available for shipment | Available now |
sa41926 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa17396 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa17863
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000111976 | Nonsense | 102 | 1012 | 3 | 28 |
- Genomic Location (Zv9):
- Chromosome 12 (position 877214)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 674338 GRCz11 12 680279 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTGTTCTATTCCCGCAGGTATTCAGTGAGTAAAGCAGACGCGGGTGAGTA[T/A]GTGCTGTGYGATGTGATTGGCTGYGTGGTGAACCACAGCTGGAGGACGGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa9151
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000111976 | Essential Splice Site | 168 | 1012 | 3 | 28 |
- Genomic Location (Zv9):
- Chromosome 12 (position 877014)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 674138 GRCz11 12 680079 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GGCCACGCTGGAGGAACAAMACTCCAGAGACGAGGACACGCKGACMGCTG[G/A]TACGACACACACAATRACAGTAATTAGCAGACAGCAGATTGTGTTTGTAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa19016
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000111976 | Essential Splice Site | 305 | 1012 | 7 | 28 |
- Genomic Location (Zv9):
- Chromosome 12 (position 872564)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 669688 GRCz11 12 675629 - KASP Assay ID:
- 2260-4762.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTGGAGCGTCACTGCTGCATCCGGCGAAAGGACATCAACACTGGACCCAG[G/T]TTATTATAGCTTATTTTGAAAAAAAGTTTTATTTTGATACTACACTGAAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa21990
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Missense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000111976 | Missense | 480 | 1012 | 15 | 28 |
- Genomic Location (Zv9):
- Chromosome 12 (position 868590)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 665714 GRCz11 12 671655 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CATGTATTAATGTCTTCATCTGTCAGTAAATCTCTCCTCCTGCTGCTGCA[G/A]TGACCGTGAGCTGCTGGTGGCTCTGGAAGCGATGCTCTTCTGGATGTCTA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa41926
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000111976 | Essential Splice Site | 627 | 1012 | 17 | 28 |
- Genomic Location (Zv9):
- Chromosome 12 (position 862082)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 659206 GRCz11 12 665147 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACACACACACACACACACACACACACACACACACACTGTAGCTGTGTTTA[C/A]ATCCAAACATATCCCATCATAAAACATTTGAAATTTCAAAATGAAGATGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa17396
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000111976 | Essential Splice Site | 891 | 1012 | 25 | 28 |
- Genomic Location (Zv9):
- Chromosome 12 (position 858932)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 656056 GRCz11 12 661997 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CTACTTTTCTCTAATTGGTCAGATGGCYCMTACTCTCCTCTAATTGGTCA[G/A]ATGTCCAATRTTCTAAACTGATTGGTCAAATTACCCCACTCTACTTTAAT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)
- Crohn's disease: Genome-wide meta-analysis increases to 71 the number of confirmed Crohn's disease susceptibility loci. (View Study)
- Dietary macronutrient intake: Novel locus including FGF21 is associated with dietary macronutrient intake. (View Study)
- Retinal vascular caliber: Four novel Loci (19q13, 6q24, 12q24, and 5q14) influence the microcirculation in vivo. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: