
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
fam171a1
- Ensembl ID:
- ENSDARG00000079788
- ZFIN ID:
- ZDB-GENE-061208-1
- Human Orthologue:
- FAM171A1
- Human Description:
- family with sequence similarity 171, member A1 [Source:HGNC Symbol;Acc:23522]
- Mouse Orthologue:
- Fam171a1
- Mouse Description:
- family with sequence similarity 171, member A1 Gene [Source:MGI Symbol;Acc:MGI:2442917]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa15232 | Nonsense | Available for shipment | Available now |
sa42738 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa15232
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000109450 | Nonsense | 337 | 888 | 8 | 9 |
- Genomic Location (Zv9):
- Chromosome 16 (position 30801372)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 28638510 GRCz11 16 28573133 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTNAATTCAGTAGTCAAMTTGAACAATGCTTCTGTGTTTCAGGAGGAAGTG[T/A]ACCCGTTTGCGGCCTGCTCACCGGAAGTTCACATTATCCTCAGCTTTGGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa42738
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000109450 | Nonsense | 358 | 888 | 8 | 9 |
- Genomic Location (Zv9):
- Chromosome 16 (position 30801433)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 28638571 GRCz11 16 28573194 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGCCTGCTCACCGGAAGTTCACATTATCCTCAGCTTTGGATGGCTCTAAA[C/T]GAGACCAGGCTACTTCCATGTCCCACCTTAACCTCATCAATGAGACTCAC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: