ENSDARG00000079782 - Zebrafish Mutation Project

Search Zebrafish Mutation Project

e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457

You can look for mutant lines by browsing a complete list or by searching for a particular gene

vmhcl

Ensembl ID:: ENSDARG00000079782
ZFIN ID:: ZDB-GENE-061027-393
Description:: ventricular myosin heavy chain-like [Source:RefSeq peptide;Acc:NP_001070932]
Human Orthologues:: MYH6, MYH7
Human Descriptions:: myosin, heavy chain 6, cardiac muscle, alpha [Source:HGNC Symbol;Acc:7576]; myosin, heavy chain 7, cardiac muscle, beta [Source:HGNC Symbol;Acc:7577]
Mouse Orthologues:: Myh6, Myh7
Mouse Descriptions:: myosin, heavy polypeptide 6, cardiac muscle, alpha Gene [Source:MGI Symbol;Acc:MGI:97255]; myosin, heavy polypeptide 7, cardiac muscle, beta Gene [Source:MGI Symbol;Acc:MGI:2155600]

Alleles

There are 7 alleles of this gene:

Allele name	Consequence	Status	Availability Estimate
sa18394	Nonsense	Available for shipment	Available now
sa6839	Essential Splice Site	Mutation detected in F1 DNA	During 2018
sa19748	Nonsense	Available for shipment	Available now
sa19749	Essential Splice Site	Available for shipment	Available now
sa39820	Essential Splice Site	Mutation detected in F1 DNA	During 2018
sa16260	Nonsense	Available for shipment	Available now
sa39821	Nonsense	Mutation detected in F1 DNA	During 2018

Mutation Details

Allele Name:: sa18394
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: Order Allele From ZIRC
Order Allele From EZRC
Mutation:: C > A
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000078958	Nonsense	555	1943	14	37
ENSDART00000123064	Nonsense	546	638	16	17
ENSDART00000123565		None	242	None	8
ENSDART00000128784	Nonsense	551	1936	16	39
ENSDART00000137560		None	99	None	2
ENSDART00000141922		None	167	None	4

The following transcripts of ENSDARG00000079782 do not overlap with this mutation:

Genomic Location (Zv9):

Chromosome 2 (position 23579941)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	2	24628554
GRCz11	2	24284205

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

GAGTGCATGTTTCCCAAAGCCAGTGATGCAAYCTTTAAAGCAAAGCTTTA[C/A]GACAACCATCTTGGGAAATCAAACAATTTCCAGAAACCCAGGCTTGTKAA

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa6839
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2018.
Mutation:: A > C
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000078958	Essential Splice Site	901	1943	20	37
ENSDART00000123064		None	638	None	17
ENSDART00000123565		None	242	None	8
ENSDART00000128784	Essential Splice Site	894	1936	22	39
ENSDART00000137560		None	99	None	2
ENSDART00000141922		None	167	None	4

The following transcripts of ENSDARG00000079782 do not overlap with this mutation:

Genomic Location (Zv9):

Chromosome 2 (position 23583582)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	2	24624913
GRCz11	2	24280564

KASP Assay ID:

554-5235.1 (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

AATACAAGATCTGTATGCAGGTAATGCATTATCTATTAAATATATTTAAC[A/C]GGAGCAAGACAACCTCTGTGATGCTGAAGAAAGGTGTGAAGGTCTGATCA

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa19748
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: Order Allele From ZIRC
Mutation:: C > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000078958	Nonsense	1110	1943	23	37
ENSDART00000123064		None	638	None	17
ENSDART00000123565		None	242	None	8
ENSDART00000128784	Nonsense	1103	1936	25	39
ENSDART00000137560		None	99	None	2
ENSDART00000141922		None	167	None	4

The following transcripts of ENSDARG00000079782 do not overlap with this mutation:

Genomic Location (Zv9):

Chromosome 2 (position 23584459)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	2	24624036
GRCz11	2	24279687

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

AAATCAGTCAGCTCAACAGTAAAATCGACGATGAGCAAAGCATAATTATC[C/T]AACTCCAAAAGAAACTCAAGGAGTTGCAGGTACATTGACCATACGTGATG

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa19749
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: Order Allele From ZIRC
Mutation:: T > C
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000078958	Essential Splice Site	1119	1943	23	37
ENSDART00000123064		None	638	None	17
ENSDART00000123565		None	242	None	8
ENSDART00000128784	Essential Splice Site	1112	1936	25	39
ENSDART00000137560		None	99	None	2
ENSDART00000141922		None	167	None	4

The following transcripts of ENSDARG00000079782 do not overlap with this mutation:

Genomic Location (Zv9):

Chromosome 2 (position 23584490)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	2	24624005
GRCz11	2	24279656

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

TGAGCAAAGCATAATTATCCAACTCCAAAAGAAACTCAAGGAGTTGCAGG[T/C]ACATTGACCATACGTGATGTTCTGTTCATCTTTGTAGTGTGCATTTTTAA

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa39820
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2018.
Mutation:: G > A
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000078958	Essential Splice Site	1249	1943	24	37
ENSDART00000123064		None	638	None	17
ENSDART00000123565		None	242	None	8
ENSDART00000128784	Essential Splice Site	1242	1936	26	39
ENSDART00000137560		None	99	None	2
ENSDART00000141922		None	167	None	4

The following transcripts of ENSDARG00000079782 do not overlap with this mutation:

Genomic Location (Zv9):

Chromosome 2 (position 23584960)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	2	24623535
GRCz11	2	24279186

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

TGGAGTTGGATGATGTAGCCTCCAGCATGGAGCATATTGTGAAGTCCAAG[G/A]TGAATTGAATTGCTTGACTTTTTTAAAAGAACAACGAAATTACAATTCAA

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa16260
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: Order Allele From ZIRC
Order Allele From EZRC
Mutation:: A > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000078958	Nonsense	1507	1943	29	37
ENSDART00000123064		None	638	None	17
ENSDART00000123565		None	242	None	8
ENSDART00000128784	Nonsense	1500	1936	31	39
ENSDART00000137560		None	99	None	2
ENSDART00000141922		None	167	None	4

The following transcripts of ENSDARG00000079782 do not overlap with this mutation:

Genomic Location (Zv9):

Chromosome 2 (position 23586853)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	2	24621642
GRCz11	2	24277293

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

AKTTGAAGAACTCATATGAGGAATCTATRGATCACCTGGAAACCATGAAG[A/T]GAGAGAACAAGATTCTGCAAGGTTTCTATTTTATACACSTTTCCAWAAAC

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa39821
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2018.
Mutation:: C > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000078958	Nonsense	1809	1943	33	37
ENSDART00000123064		None	638	None	17
ENSDART00000123565		None	242	None	8
ENSDART00000128784	Nonsense	1802	1936	35	39
ENSDART00000137560		None	99	None	2
ENSDART00000141922		None	167	None	4

The following transcripts of ENSDARG00000079782 do not overlap with this mutation:

Genomic Location (Zv9):

Chromosome 2 (position 23588105)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	2	24620390
GRCz11	2	24276041

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

ACATGGAGCAGACCATTAAGGACCTGCAGCATCGCCTGGATGAAGCAGAA[C/T]AAATCGCTATGAAGGGAGGAAAGAAACAAGTCCAGAAACTGGAGGCCAGG

Associated Phenotype:

Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

Electrocardiographic traits: Several common variants modulate heart rate, PR interval and QRS duration. (View Study)
Resting heart rate: Common genetic variation near the connexin-43 gene is associated with resting heart rate in African Americans: a genome-wide association study of 13,372 participants. (View Study)
Resting heart rate: Genome-wide association analysis identifies multiple loci related to resting heart rate. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

OMIM

More OMIM information for MYH6

More OMIM information for MYH7

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: