vmhcl

Ensembl ID:
ENSDARG00000079782
ZFIN ID:
ZDB-GENE-061027-393
Description:
ventricular myosin heavy chain-like [Source:RefSeq peptide;Acc:NP_001070932]
Human Orthologues:
MYH6, MYH7
Human Descriptions:
myosin, heavy chain 6, cardiac muscle, alpha [Source:HGNC Symbol;Acc:7576]
myosin, heavy chain 7, cardiac muscle, beta [Source:HGNC Symbol;Acc:7577]
Mouse Orthologues:
Myh6, Myh7
Mouse Descriptions:
myosin, heavy polypeptide 6, cardiac muscle, alpha Gene [Source:MGI Symbol;Acc:MGI:97255]
myosin, heavy polypeptide 7, cardiac muscle, beta Gene [Source:MGI Symbol;Acc:MGI:2155600]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18394 Nonsense Available for shipment Available now
sa6839 Essential Splice Site Mutation detected in F1 DNA During 2018
sa19748 Nonsense Available for shipment Available now
sa19749 Essential Splice Site Available for shipment Available now
sa39820 Essential Splice Site Mutation detected in F1 DNA During 2018
sa16260 Nonsense Available for shipment Available now
sa39821 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa18394
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078958 Nonsense 555 1943 14 37
ENSDART00000123064 Nonsense 546 638 16 17
ENSDART00000123565   None 242 None 8
ENSDART00000128784 Nonsense 551 1936 16 39
ENSDART00000137560   None 99 None 2
ENSDART00000141922   None 167 None 4

The following transcripts of ENSDARG00000079782 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 23579941)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24628554
GRCz11 2 24284205
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGTGCATGTTTCCCAAAGCCAGTGATGCAAYCTTTAAAGCAAAGCTTTA[C/A]GACAACCATCTTGGGAAATCAAACAATTTCCAGAAACCCAGGCTTGTKAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6839
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078958 Essential Splice Site 901 1943 20 37
ENSDART00000123064   None 638 None 17
ENSDART00000123565   None 242 None 8
ENSDART00000128784 Essential Splice Site 894 1936 22 39
ENSDART00000137560   None 99 None 2
ENSDART00000141922   None 167 None 4

The following transcripts of ENSDARG00000079782 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 23583582)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24624913
GRCz11 2 24280564
KASP Assay ID:
554-5235.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATACAAGATCTGTATGCAGGTAATGCATTATCTATTAAATATATTTAAC[A/C]GGAGCAAGACAACCTCTGTGATGCTGAAGAAAGGTGTGAAGGTCTGATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19748
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078958 Nonsense 1110 1943 23 37
ENSDART00000123064   None 638 None 17
ENSDART00000123565   None 242 None 8
ENSDART00000128784 Nonsense 1103 1936 25 39
ENSDART00000137560   None 99 None 2
ENSDART00000141922   None 167 None 4

The following transcripts of ENSDARG00000079782 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 23584459)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24624036
GRCz11 2 24279687
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATCAGTCAGCTCAACAGTAAAATCGACGATGAGCAAAGCATAATTATC[C/T]AACTCCAAAAGAAACTCAAGGAGTTGCAGGTACATTGACCATACGTGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19749
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078958 Essential Splice Site 1119 1943 23 37
ENSDART00000123064   None 638 None 17
ENSDART00000123565   None 242 None 8
ENSDART00000128784 Essential Splice Site 1112 1936 25 39
ENSDART00000137560   None 99 None 2
ENSDART00000141922   None 167 None 4

The following transcripts of ENSDARG00000079782 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 23584490)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24624005
GRCz11 2 24279656
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGCAAAGCATAATTATCCAACTCCAAAAGAAACTCAAGGAGTTGCAGG[T/C]ACATTGACCATACGTGATGTTCTGTTCATCTTTGTAGTGTGCATTTTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39820
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078958 Essential Splice Site 1249 1943 24 37
ENSDART00000123064   None 638 None 17
ENSDART00000123565   None 242 None 8
ENSDART00000128784 Essential Splice Site 1242 1936 26 39
ENSDART00000137560   None 99 None 2
ENSDART00000141922   None 167 None 4

The following transcripts of ENSDARG00000079782 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 23584960)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24623535
GRCz11 2 24279186
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAGTTGGATGATGTAGCCTCCAGCATGGAGCATATTGTGAAGTCCAAG[G/A]TGAATTGAATTGCTTGACTTTTTTAAAAGAACAACGAAATTACAATTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16260
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078958 Nonsense 1507 1943 29 37
ENSDART00000123064   None 638 None 17
ENSDART00000123565   None 242 None 8
ENSDART00000128784 Nonsense 1500 1936 31 39
ENSDART00000137560   None 99 None 2
ENSDART00000141922   None 167 None 4

The following transcripts of ENSDARG00000079782 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 23586853)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24621642
GRCz11 2 24277293
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AKTTGAAGAACTCATATGAGGAATCTATRGATCACCTGGAAACCATGAAG[A/T]GAGAGAACAAGATTCTGCAAGGTTTCTATTTTATACACSTTTCCAWAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39821
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078958 Nonsense 1809 1943 33 37
ENSDART00000123064   None 638 None 17
ENSDART00000123565   None 242 None 8
ENSDART00000128784 Nonsense 1802 1936 35 39
ENSDART00000137560   None 99 None 2
ENSDART00000141922   None 167 None 4

The following transcripts of ENSDARG00000079782 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 23588105)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24620390
GRCz11 2 24276041
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATGGAGCAGACCATTAAGGACCTGCAGCATCGCCTGGATGAAGCAGAA[C/T]AAATCGCTATGAAGGGAGGAAAGAAACAAGTCCAGAAACTGGAGGCCAGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link