zgc:112998

Ensembl ID:
ENSDARG00000079760
ZFIN ID:
ZDB-GENE-050320-134
Description:
hypothetical protein LOC541430 [Source:RefSeq peptide;Acc:NP_001013574]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13329 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13329
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114352 Nonsense 27 392 2 3
Genomic Location (Zv9):
Chromosome 15 (position 42923387)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 44072367
GRCz11 15 44095810
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCTGTTTGACCCAGAATCATCCATAATAAAACAAGAAGATCCTGAAGAA[C/T]AAACAGGTGGGTGTACAGTTTTAGTAATAMAGATAATGCAATCAACATAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link