
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
SCARF2
- Ensembl ID:
- ENSDARG00000079757
- Description:
- scavenger receptor class F, member 2 [Source:HGNC Symbol;Acc:19869]
- Human Orthologue:
- SCARF2
- Human Description:
- scavenger receptor class F, member 2 [Source:HGNC Symbol;Acc:19869]
- Mouse Orthologue:
- Scarf2
- Mouse Description:
- scavenger receptor class F, member 2 Gene [Source:MGI Symbol;Acc:MGI:1858430]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa33538 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa33538
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000114953 | Essential Splice Site | 692 | 745 | 15 | 15 |
- Genomic Location (Zv9):
- Chromosome 5 (position 12449862)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 10861037 GRCz11 5 11361404 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCCCTTCTTCCCACTTCCAGCAACCTCCAGAAGATGGTGGCTCCTATTTC[A/C]GACTCTACTCCTGAAGCCAAAAGCCCAGAAAAACAAGGGCTCAATGGGAC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: