si:dkey-202m9.3
- Ensembl ID:
- ENSDARG00000079752
- ZFIN ID:
- ZDB-GENE-041111-303
- Human Orthologues:
- COL6A5, COL6A6
- Human Descriptions:
- collagen, type VI, alpha 5 [Source:HGNC Symbol;Acc:26674]
- collagen, type VI, alpha 6 [Source:HGNC Symbol;Acc:27023]
- Mouse Orthologues:
- AC119951.1, Col6a4, Col6a6
- Mouse Descriptions:
- collagen alpha-5(VI) chain precursor [Source:RefSeq peptide;Acc:NP_001161395]
- collagen, type VI, alpha 4 Gene [Source:MGI Symbol;Acc:MGI:1915803]
- collagen, type VI, alpha 6 Gene [Source:MGI Symbol;Acc:MGI:2444259]
Alleles
There are 12 alleles of this gene:
Allele name |
Consequence |
Status |
Availability Estimate |
sa9393 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa36205 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa17668 |
Nonsense |
Available for shipment |
Available now |
sa36207 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa39119 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa44856 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa22900 |
Essential Splice Site |
Available for shipment |
Available now |
sa565 |
Nonsense |
Available for shipment |
Available now |
sa36208 |
Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa14196 |
Nonsense |
Available for shipment |
Available now |
sa12050 |
Essential Splice Site |
Available for shipment |
Available now |
sa5895 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
Mutation Details
- Allele Name:
- sa9393
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000109703 |
Nonsense |
88 |
2543 |
1 |
39 |
- Genomic Location (Zv9):
- Chromosome 16 (position 38076959)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
16 |
36717442 |
GRCz11 |
16 |
36671326 |
- KASP Assay ID:
- 2261-0054.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- GAGCTGTTYAGGAAAATAGACAACCTTCCATACCGAACCGGAGGCACGTA[T/A]ATGGGAAAAGCCATGAATTTYCTAAAGGACAATTACTTCACAAGTGCWGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa36205
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > G
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000109703 |
Nonsense |
191 |
2543 |
1 |
39 |
- Genomic Location (Zv9):
- Chromosome 16 (position 38077267)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
16 |
36717750 |
GRCz11 |
16 |
36671634 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCAAGCATTGCAAGGACTGACGACCACTATGAAGGAGACAGTGTGTGTCT[T/G]AATGAGGGATCAGGGGAAAGGTAAAGTACATTTTGCAACCCTGTTTTGTA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa17668
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000109703 |
Nonsense |
219 |
2543 |
2 |
39 |
- Genomic Location (Zv9):
- Chromosome 16 (position 38081187)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
16 |
36721670 |
GRCz11 |
16 |
36675554 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- AGTTTACTGATGTAWTTGTGTTGGTGGACAGTACAGCTCAGGGGGAAAYA[C/T]AGCAAATAAGGGAACTTCTCAACCGACTGCTTGTGCAGCTCAATGTGGGY
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa36207
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000109703 |
Nonsense |
599 |
2543 |
4 |
39 |
- Genomic Location (Zv9):
- Chromosome 16 (position 38087158)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
16 |
36727641 |
GRCz11 |
16 |
36681525 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATTTAATCCTTACCTTCAGGATGTGTGAACACAGAGGAAGCAGACATTTA[T/A]TTCCTGTTGGACAACTCTGGCAGCACTCGCGCCGACTTTGAAGATGTGAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa39119
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000109703 |
Essential Splice Site |
775 |
2543 |
4 |
39 |
- Genomic Location (Zv9):
- Chromosome 16 (position 38087686)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
16 |
36728169 |
GRCz11 |
16 |
36682053 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTGAATGTTCTCAAGCGAGAAATTGTCACAGATATTTGCTCTCAAGAGGG[T/C]AAGAGAGTTATCAAACATATACAGCAACATATTGTTGTTTCTTTTTTTTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa44856
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000109703 |
Essential Splice Site |
962 |
2543 |
5 |
39 |
- Genomic Location (Zv9):
- Chromosome 16 (position 38090673)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
16 |
36731156 |
GRCz11 |
16 |
36685040 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCCATCGACAAAAACCTACAATTCAAGCTCTGCAGCTCTCACCCTGGCGG[T/A]GAGTCAGTTTACCATGAAAGCCATTTTTGTTAGCAAATTACAGTTGGTGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa22900
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000109703 |
Essential Splice Site |
1672 |
2543 |
17 |
39 |
- Genomic Location (Zv9):
- Chromosome 16 (position 38106298)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
16 |
36746781 |
GRCz11 |
16 |
36700665 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTCAGGAAGCTCAGGAAGCCCAGGACAACGAGGCCTGAGAGGAGATCCGG[T/G]TAGTAGAATTCAGCTGCAAATAAATCTCTTAAAGGGATAGTTCACCCAAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa565
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000109703 |
Nonsense |
2034 |
2543 |
32 |
39 |
- Genomic Location (Zv9):
- Chromosome 16 (position 38113026)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
16 |
36753509 |
GRCz11 |
16 |
36707393 |
- KASP Assay ID:
- 554-0475.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- GAGTGCGAAAAGGCRTCCTGATGAGGAAGGTTGCCATTTTCCTYACTGCT[G/T]GAGAATCTCAAGATTCGATATCTCTCACCACTGCCATTCTAGAGTACAAA
- Associated Phenotype:
Normal
Mutation Details
- Allele Name:
- sa36208
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > A
- Consequence:
- Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000109703 |
Splice Site |
None |
2543 |
None |
39 |
- Genomic Location (Zv9):
- Chromosome 16 (position 38114650)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
16 |
36755133 |
GRCz11 |
16 |
36709017 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTCTCCAGAACTTTTTCCACCTATTTATTGTATGATAACATCTTTTCACA[T/A]CCAAGATCCCTGCAGACCAGCTAGAGAATGTGAGGGCACCAACCTGCCAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa14196
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000109703 |
Nonsense |
2294 |
2543 |
34 |
39 |
- Genomic Location (Zv9):
- Chromosome 16 (position 38115224)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
16 |
36755707 |
GRCz11 |
16 |
36709591 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- ACAGTGGGAGACTCCATCGCCTCTAGTCAGGTGGAGGAGCTTGCCAGCTA[T/A]CCTTTAGWACAGCACATCATTCACCTGGGCCACTTGAAACATGGAGAACA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa12050
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000109703 |
Essential Splice Site |
2327 |
2543 |
34 |
39 |
- Genomic Location (Zv9):
- Chromosome 16 (position 38115323)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
16 |
36755806 |
GRCz11 |
16 |
36709690 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- CAGGAGTACACACAACGCTTCATGAGGACTTTCTTCCATATACTGAGCAG[T/C]AAGGAGTKTTTCATGTTAATGCTGATTTGAWTTGGGTCAAAAGAATTGCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa5895
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000109703 |
Essential Splice Site |
2484 |
2543 |
38 |
39 |
- Genomic Location (Zv9):
- Chromosome 16 (position 38123962)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
16 |
36764445 |
GRCz11 |
16 |
36718329 |
- KASP Assay ID:
- 554-3911.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- GATCCTGAAGTAATCCCACAGACACAAGTTGAAACGGCTTTATTTAATGG[T/A]AAGGATTGAGCCACATTTGTAACATTTTCTTGCCTTGTCTGGCTTTTGCT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes
(for example, a new allele is generated or an allele is made available
for distribution) then please enter your details below: