zgc:158741

Ensembl ID:
ENSDARG00000079751
ZFIN ID:
ZDB-GENE-070112-1022
Human Orthologue:
MEGF8
Human Description:
multiple EGF-like-domains 8 [Source:HGNC Symbol;Acc:3233]
Mouse Orthologue:
Megf8
Mouse Description:
multiple EGF-like-domains 8 Gene [Source:MGI Symbol;Acc:MGI:2446294]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa28664 Nonsense Mutation detected in F1 DNA During 2018
sa42729 Nonsense Mutation detected in F1 DNA During 2018
sa5893 Nonsense Mutation detected in F1 DNA During 2018
sa36149 Essential Splice Site Mutation detected in F1 DNA During 2018
sa25014 Essential Splice Site Mutation detected in F1 DNA During 2018
sa12032 Essential Splice Site, Missense Available for shipment Available now
sa36148 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa28664
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110951 Nonsense 260 2774 5 50
ENSDART00000142056   None 2340 None 33

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 28679696)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 26555470
GRCz11 16 26428912
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCACTGGAGGACCTTGTTGTTTACAATTTTTCAACCAACAGTTGGGAA[C/T]AGATGACATTCTCGCATAGTCCAGTAAGATCCTTTATCTCTTAAAAATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42729
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110951 Nonsense 543 2774 12 50
ENSDART00000142056   None 2340 None 33
Genomic Location (Zv9):
Chromosome 16 (position 28671416)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 26547190
GRCz11 16 26420632
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTTTTTTTAAATATTAATACATTGTTATATTTTCTGTCAATTTATCT[T/A]ACATATAAATAATAAAAACCTTAATTCAAACATAAAATTTTATTGGCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5893
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110951 Nonsense 2095 2774 42 50
ENSDART00000142056 Nonsense 1577 2340 27 33
Genomic Location (Zv9):
Chromosome 16 (position 28641775)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 26517549
GRCz11 16 26390991
KASP Assay ID:
554-3834.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCACAGTGTGGCTGGTGTGCTGGCCGTGGTGGTAATGGTTCAGGCCGCTG[T/A]CTGCAGGGAGGACTCAATGGTACGTGTTTTACATTACAGTAATGGAAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36149
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110951 Essential Splice Site 2222 2774 44 50
ENSDART00000142056 Essential Splice Site 1704 2340 29 33
Genomic Location (Zv9):
Chromosome 16 (position 28639268)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 26515042
GRCz11 16 26388484
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGCATCTCTCAGCTGGACACCTGTCTAGAGTGCAAGAATAACACTAAG[G/A]TACTAAGAACTAGCATTGTATGTGGTTTTATTTTTTCGTATTAATATGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25014
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110951 Essential Splice Site 2323 2774 46 50
ENSDART00000142056 Essential Splice Site 1805 2340 31 33
Genomic Location (Zv9):
Chromosome 16 (position 28637315)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 26513089
GRCz11 16 26386531
KASP Assay ID:
554-7886.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGAGAGCTGCCTCAGCGGCTACTTCCTGCTGCAAGGGAAGTGTGAGAA[G/A]TAAGTCCTTAAGAAAATTACCTTTGAGTCCAATCTCTTACACTAATTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12032
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110951 Essential Splice Site 2658 2774 49 50
ENSDART00000142056 Missense 2147 2340 33 33
Genomic Location (Zv9):
Chromosome 16 (position 28634315)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 26510089
GRCz11 16 26383531
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTACTGTCTACCTGGAGCCAGAGGAGCCACAGTTAGTTTACTTGCCCTCA[G/A]CTGGAGGGGGCAGCGCAGTGTCTCTGGCCCACGTCCGRACAGGCAAGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36148
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110951   None 2774 None 50
ENSDART00000142056 Nonsense 2232 2340 33 33
Genomic Location (Zv9):
Chromosome 16 (position 28634058)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 26509832
GRCz11 16 26383274
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACGCACCCAGCTCCACCGCCAACCCAACCTCACATCACCAACACCATTA[T/A]CCGTCCTCGCATGGCAGCTACCAGCATTTCTGCCGCTCCGACCCTTTCCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link