zgc:171837

Ensembl ID:
ENSDARG00000079749
ZFIN ID:
ZDB-GENE-080204-99
Description:
zinc finger protein 341 [Source:RefSeq peptide;Acc:NP_001108045]
Human Orthologue:
ZNF341
Human Description:
zinc finger protein 341 [Source:HGNC Symbol;Acc:15992]
Mouse Orthologue:
Zfp341
Mouse Description:
zinc finger protein 341 Gene [Source:MGI Symbol;Acc:MGI:2682937]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24831 Nonsense Available for shipment Available now
sa44435 Essential Splice Site Mutation detected in F1 DNA During 2018
sa39524 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa24831
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114834 Nonsense 196 796 5 16
Genomic Location (Zv9):
Chromosome Zv9_NA947 (position 35817)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 43606646
GRCz11 23 43499010
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCCTCTCACAGGTATCATCTAGCAACAGCAGTTCAGTGGTGCAGGTGTA[C/A]AGCGCACTGCCCCCGCTGACCGGAGCAGGAACTGCAGAGGTGCCCGCGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44435
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114834 Essential Splice Site 315 796 7 16
Genomic Location (Zv9):
Chromosome Zv9_NA947 (position 41033)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 43611862
GRCz11 23 43504226
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGAAAAAGTGTTTACCAAGAACTTTGACCTCCAGCAGCACATCAGAAG[G/A]TAAACCAGCAGATTTAATATCATGTTGTTTTTGTTGTTTATATTCATTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39524
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114834 Essential Splice Site 650 796 15 16
Genomic Location (Zv9):
Chromosome Zv9_NA947 (position 54071)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 43624900
GRCz11 23 43517264
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTCTTTTTTTCTGAATGTGGCTGTGTTAATGGTGTGCTGTTTGTCTGC[A/C]GGTATAAAGCCGTTCAAGTGTCAGGTGTGTCAGAAGTCGTTCAGTCGGCG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link