
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-166a6.5
- Ensembl ID:
- ENSDARG00000079745
- ZFIN ID:
- ZDB-GENE-030131-9913
- Description:
- Novel protein [Source:UniProtKB/TrEMBL;Acc:B0S504]
- Human Orthologue:
- KIAA0664
- Human Description:
- KIAA0664 [Source:HGNC Symbol;Acc:29094]
- Mouse Orthologue:
- 1300001I01Rik
- Mouse Description:
- RIKEN cDNA 1300001I01 gene Gene [Source:MGI Symbol;Acc:MGI:1921398]
Alleles
There are 6 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa38662 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa21182 | Essential Splice Site | Available for shipment | Available now |
sa7620 | Missense | Mutation detected in F1 DNA | During 2018 |
sa13449 | Essential Splice Site | Available for shipment | Available now |
sa7117 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa34285 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa38662
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000114890 | Nonsense | 100 | 1315 | 3 | 27 |
ENSDART00000141915 | None | 717 | None | 16 |
The following genes are also affected by this mutation:
- Genomic Location (Zv9):
- Chromosome 8 (position 4693325)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 4436356 GRCz11 8 4493062 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TAACTCTTGACCCCATGATGGAGCTCCAGGACATCAAAGGCTTCAAAGCT[G/T]GAGTTACTCTTCGTCTAGTGGAAGGTAAACTGGAGGAGCTCTACTTTAGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa21182
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000114890 | Essential Splice Site | 254 | 1315 | None | 27 |
ENSDART00000141915 | None | 717 | None | 16 |
The following genes are also affected by this mutation:
- Genomic Location (Zv9):
- Chromosome 8 (position 4683315)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 4426346 GRCz11 8 4483052 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCAAGCAGTGTGACATCACTTCCTGCCCACGTGGATTTTACCTGAACAGG[T/C]ACGAGAGTTTCATTTCAGAACTGCATTCTGCTCTATTTCTGCATTACAAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa7620
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Missense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000114890 | Missense | 602 | 1315 | 12 | 27 |
ENSDART00000141915 | Missense | 4 | 717 | 1 | 16 |
- Genomic Location (Zv9):
- Chromosome 8 (position 4670767)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 4413798 GRCz11 8 4470504 - KASP Assay ID:
- 554-4307.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CCYTTACCCTCGGGTCTTATGAACGTGATTTGCCTRTATATTTCAGACAT[G/A]CTCAGTTCACGCAGCGAGTGAAGGCTCACTTGGAGGAGAACGGAGGACTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa13449
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000114890 | Essential Splice Site | 970 | 1315 | 20 | 27 |
ENSDART00000141915 | Essential Splice Site | 372 | 717 | 9 | 16 |
- Genomic Location (Zv9):
- Chromosome 8 (position 4656038)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 4399069 GRCz11 8 4455775 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TCTYAGTCTKCTGGCAAAAGTTGCYYATGTTCAGGGTCATCCTGCTGAGG[T/C]GTGTTNNNNNNNNNNNNNNGGGTGTGTCTTCCTWCCCAGTGTGTCCAAAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa7117
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000114890 | Nonsense | 1019 | 1315 | 22 | 27 |
ENSDART00000141915 | Nonsense | 421 | 717 | 11 | 16 |
- Genomic Location (Zv9):
- Chromosome 8 (position 4653193)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 4396224 GRCz11 8 4452930 - KASP Assay ID:
- 554-4069.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TRTATCTGTATGCCGGKGGTGAAGCGGCTCTGGCTCAGCGATGTCTTTAT[C/T]GAGCCAAAGTCCTCCTGCTGACGATTCATGGAGGAGATCATCCGTACACT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa34285
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000114890 | Nonsense | 1179 | 1315 | 27 | 27 |
ENSDART00000141915 | Nonsense | 581 | 717 | 16 | 16 |
- Genomic Location (Zv9):
- Chromosome 8 (position 4646714)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 4389745 GRCz11 8 4446451 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGGATACGGCTGAATGCTTTTATCATTGTCGCTTAAGCACAAGAATGATG[G/T]AGTTTAAAGAGAAACTGAAAGAGAAGAAAGCAGCAGAAGAGGCAGAAAAG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: