zgc:56148

Ensembl ID:
ENSDARG00000079717
ZFIN ID:
ZDB-GENE-030131-6428
Description:
hypothetical protein LOC334496 [Source:RefSeq peptide;Acc:NP_956199]
Human Orthologue:
RBM12B
Human Description:
RNA binding motif protein 12B [Source:HGNC Symbol;Acc:32310]
Mouse Orthologues:
C430048L16Rik, Rbm12b
Mouse Descriptions:
RIKEN cDNA C430048L16 gene Gene [Source:MGI Symbol;Acc:MGI:1924854]
RNA binding motif protein 12B Gene [Source:MGI Symbol;Acc:MGI:1919647]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36078 Essential Splice Site, Missense Mutation detected in F1 DNA During 2018
sa13723 Nonsense Available for shipment Available now
sa19137 Nonsense Mutation detected in F1 DNA During 2018
sa10416 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36078
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111912 Missense 314 665 1 2
ENSDART00000114435 Essential Splice Site 314 314 None 4
ENSDART00000139991 Missense 314 685 2 2
Genomic Location (Zv9):
Chromosome 16 (position 18284960)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 16326197
GRCz11 16 16234174
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTGCTTTAAAGGATGATCAGATAATTATCTTCTCCTCGAAAAAGGATGA[T/A]AAGTCCAAATCGGCTGTTGTGGTGTTTAGAAGTCTGACAGACTATTGTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13723
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111912 Nonsense 414 665 1 2
ENSDART00000114435   None 314 3 4
ENSDART00000139991 Nonsense 414 685 2 2
Genomic Location (Zv9):
Chromosome 16 (position 18284660)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 16325897
GRCz11 16 16233874
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCCGTTTGATGTTCGWAAGGTGGAGATCATGGACTTCTKTCATGGATA[T/A]GCGCTCACGGAGGATAGGGTCATCTTATTGCGGGATGAAAGAGGAGCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19137
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111912 Nonsense 610 665 2 2
ENSDART00000114435   None 314 4 4
ENSDART00000139991 Nonsense 630 685 2 2
ENSDART00000111912 Nonsense 610 665 2 2
ENSDART00000114435   None 314 4 4
ENSDART00000139991 Nonsense 630 685 2 2
Genomic Location (Zv9):
Chromosome 16 (position 18284012)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 16325249
GRCz11 16 16233226
KASP Assay ID:
2260-9423.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCAATCTGCCCTCACAGATAAGAATAGAAGAAATCTATGACTTCTGCTA[T/A]GGGTACAGAGTGATTCCAGGATCTGCCTCGTTGCTGTTTGATAGGAATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10416
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111912 Nonsense 610 665 2 2
ENSDART00000114435   None 314 4 4
ENSDART00000139991 Nonsense 630 685 2 2
ENSDART00000111912 Nonsense 610 665 2 2
ENSDART00000114435   None 314 4 4
ENSDART00000139991 Nonsense 630 685 2 2
Genomic Location (Zv9):
Chromosome 16 (position 18284012)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 16325249
GRCz11 16 16233226
KASP Assay ID:
2260-9423.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCAATCTGCCCTCACAGATAAGAATMGAAGAAATCTATGACTTCTGCTA[T/A]GGGTACAGAGTGATTCCAGGATCTGCCTCGTTGCTGTTTGATAGGAATGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link