sin3aa

Ensembl ID:
ENSDARG00000079716
ZFIN ID:
ZDB-GENE-070620-3
Description:
transcriptional co-repressor Sin3A [Source:RefSeq peptide;Acc:NP_001091650]
Human Orthologue:
SIN3A
Human Description:
SIN3 homolog A, transcription regulator (yeast) [Source:HGNC Symbol;Acc:19353]
Mouse Orthologue:
Sin3a
Mouse Description:
transcriptional regulator, SIN3A (yeast) Gene [Source:MGI Symbol;Acc:MGI:107157]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17441 Essential Splice Site Available for shipment Available now
sa37997 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa17441
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083539 Essential Splice Site 60 1276 2 21
ENSDART00000138782 Essential Splice Site 60 95 2 3
Genomic Location (Zv9):
Chromosome 25 (position 6736481)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 6255923
GRCz11 25 6383325
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
SCATGCAGCCCACTCCAGGAATACAGTACCCGCTTCCTCAAGCATACCAG[G/A]TACAGACACATATACCTATTTGGCCCCAANTATACTCRCAGTGAAGTCCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37997
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083539 Essential Splice Site 1135 1276 19 21
ENSDART00000138782   None 95 None 3
Genomic Location (Zv9):
Chromosome 25 (position 6707584)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 6227026
GRCz11 25 6354428
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCAGACCTGAAGGATCATCTCTCCCAGAAGCCTGTGTTTCTGCCCAGG[T/C]GAGTCCAGCCAGGCGAGTCTCGCCGTTTCTACGTGCAACACACACTTTGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: A genome-wide association study in 19 633 Japanese subjects identified LHX3-QSOX2 and IGF1 as adult height loci. (View Study)
  • Sudden cardiac arrest: GWAS for discovery and replication of genetic loci associated with sudden cardiac arrest in patients with coronary artery disease. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link