asb13

Ensembl ID:
ENSDARG00000079698
ZFIN ID:
ZDB-GENE-040718-261
Description:
ankyrin repeat and SOCS box-containing 13 [Source:RefSeq peptide;Acc:NP_001002528]
Human Orthologue:
ASB13
Human Description:
ankyrin repeat and SOCS box-containing 13 [Source:HGNC Symbol;Acc:19765]
Mouse Orthologue:
Asb13
Mouse Description:
ankyrin repeat and SOCS box-containing 13 Gene [Source:MGI Symbol;Acc:MGI:2145525]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40242 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa40242
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019458 Nonsense 271 286 6 6

The following transcripts of ENSDARG00000079698 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 10547085)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11483712
GRCz11 4 11482561
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTATGGTGGGCACCAGAGCAATGGAGCTGATCCCCAAACTAGACATTTCA[C/T]AGCGCATCATTGATTACCTCATGTTTAAATCATTGATCAGTTCTGAATAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link