zgc:194908

Ensembl ID:
ENSDARG00000079697
ZFIN ID:
ZDB-GENE-081022-164
Description:
hypothetical protein LOC797835 [Source:RefSeq peptide;Acc:NP_001129455]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20528 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20528
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114950 Nonsense 8 175 1 1
Genomic Location (Zv9):
Chromosome 5 (position 52467744)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 50134940
GRCz11 5 50781533
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCGCCGCTGCTGCTGCTGGACGGCAACTATGGAGGAGAAACACAAGGAT[G/T]AAAGCGCCAAAGACCCGCAGTCATCGTCCTACCAGAGGAGAATGTGGAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link