SYNPO2 (1 of 2)

Ensembl ID:
ENSDARG00000079675
Description:
synaptopodin 2 [Source:HGNC Symbol;Acc:17732]
Human Orthologue:
SYNPO2
Human Description:
synaptopodin 2 [Source:HGNC Symbol;Acc:17732]
Mouse Orthologue:
Synpo2
Mouse Description:
synaptopodin 2 Gene [Source:MGI Symbol;Acc:MGI:2153070]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41085 Nonsense Mutation detected in F1 DNA During 2018
sa17461 Nonsense Available for shipment Available now
sa18367 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41085
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115039 Nonsense 189 733 2 6
Genomic Location (Zv9):
Chromosome 7 (position 72585924)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 69637966
GRCz11 7 69879311
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTGCCTGAGACCAAGGGTAAAGGAGCACTCATGTTTGCCCAGCGCAAA[C/T]AGCGCATGGATGAGATAGTAGCTGAGCATGAAGAGCTGAGACGTAAGGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17461
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115039 Nonsense 510 733 5 6
Genomic Location (Zv9):
Chromosome 7 (position 72583616)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 69635648
GRCz11 7 69877003
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTACTGTGGCATCCCATGGTTTTGGTTCGGCTTTTGAGATGCCGGCAT[T/A]GAAAGGGAAAGGGGCAGAACTTTTCGCCAAGAGGCAATCCAGAATGGARA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18367
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115039 Nonsense 565 733 5 6
Genomic Location (Zv9):
Chromosome 7 (position 72583451)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 69635483
GRCz11 7 69876838
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGCCAACTTCCTGGAAATATTCACCCAATTGYCGGGCACCCCCACCTT[T/A]GGCTTATAATCCAATTCATTCACCATCATATCCCCCAGGTGCYGTCAAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link