zgc:110749

Ensembl ID:
ENSDARG00000079653
ZFIN IDs:
ZDB-GENE-050320-144, ZDB-GENE-050320-144
Description:
hypothetical protein LOC541440 [Source:RefSeq peptide;Acc:NP_001013583]
Human Orthologues:
AC008537.2, CYP2A7P1
Human Description:
cytochrome P450, family 2, subfamily A, polypeptide 7 pseudogene 1 [Source:HGNC Symbol;Acc:2612]
Mouse Orthologues:
Cyp2ab1, Cyp2j13
Mouse Descriptions:
cytochrome P450, family 2, subfamily ab, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:3644957]
cytochrome P450, family 2, subfamily j, polypeptide 13 Gene [Source:MGI Symbol;Acc:MGI:2385197]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44265 Nonsense Mutation detected in F1 DNA During 2018
sa30231 Nonsense Mutation detected in F1 DNA During 2018
sa16848 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa44265
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064591 Nonsense 93 491 2 9
ENSDART00000110692 Nonsense 107 461 2 9
Genomic Location (Zv9):
Chromosome 25 (position 17723946)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 17270787
GRCz11 25 17367187
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTTTTGCAGTTATTAAAGAAGCTCTGGTTACCAAAGCTCAAGACTTTT[C/A]AGGACGACCTCAAGACTTCATGATCAGTCACGCCACAGAGAATAAAGGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30231
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064591 Nonsense 95 491 2 9
ENSDART00000110692 Nonsense 109 461 2 9
Genomic Location (Zv9):
Chromosome 25 (position 17723941)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 17270782
GRCz11 25 17367182
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCAGTTATTAAAGAAGCTCTGGTTACCAAAGCTCAAGACTTTTCAGGA[C/T]GACCTCAAGACTTCATGATCAGTCACGCCACAGAGAATAAAGGTAACTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16848
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064591 Nonsense 402 491 8 9
ENSDART00000110692 Nonsense 416 461 8 9
Genomic Location (Zv9):
Chromosome 25 (position 17719892)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 17266733
GRCz11 25 17363133
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YCCAACCTTACYAGKGTGCTAAAAGAAGAAGGTCAGTGGAAGTTTCCTYA[T/G]GAGTTCAACCCAGCAAACTTYCTGAATGAGCAGGGCCAGTTTGAGAAGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link