zgc:175131

Ensembl ID:
ENSDARG00000079647
ZFIN ID:
ZDB-GENE-080220-61
Description:
hypothetical protein LOC799648 [Source:RefSeq peptide;Acc:NP_001107935]
Human Orthologue:
HEG1
Human Description:
HEG homolog 1 (zebrafish) [Source:HGNC Symbol;Acc:29227]
Mouse Orthologue:
Heg1
Mouse Description:
HEG homolog 1 (zebrafish) Gene [Source:MGI Symbol;Acc:MGI:1924696]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41994 Nonsense Mutation detected in F1 DNA During 2018
sa41995 Nonsense Mutation detected in F1 DNA During 2018
sa10336 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa41994
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109105   None 251 19 20
ENSDART00000114174 Nonsense 416 506 18 19
Genomic Location (Zv9):
Chromosome 12 (position 17192773)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 16072483
GRCz11 12 16121293
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCACCAGAGGTAGACTTTAGCTTAAGTTATGGCAATAAGGATTTGCAT[A/T]AACCTACAGGAGTTCCCAGGATCCCTCGGGCTAACCCTGAGTCCAACTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41995
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109105   None 251 19 20
ENSDART00000114174 Nonsense 457 506 18 19
Genomic Location (Zv9):
Chromosome 12 (position 17192896)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 16072606
GRCz11 12 16121416
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAATAGTGACAGTAATCAGAGCCTGGTGACCAGAGATCGCCCAGAAAGC[A/T]AAGGGGTAACACTACACTAAAACACTAATCATGTGCAAAAAGAAATGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10336
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109105 Essential Splice Site None 251 19 20
ENSDART00000114174 Essential Splice Site 458 506 18 19
Genomic Location (Zv9):
Chromosome 12 (position 17192902)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 16072612
GRCz11 12 16121422
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGACAGTAATCAGAGCCTGGTGACCAGAGATCGCCCAGAAAGCAAAGGG[G/A]TAACACTACACTAAAACACTAATCATGTGCAAAAAGAAATGAAATGCTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link