
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
atr
- Ensembl ID:
- ENSDARG00000079625
- ZFIN ID:
- ZDB-GENE-070912-458
- Description:
- Novel protein similar to vertebrate ataxia telangiectasia and Rad3 related (ATR) [Source:UniProtKB/T
- Human Orthologue:
- ATR
- Human Description:
- ataxia telangiectasia and Rad3 related [Source:HGNC Symbol;Acc:882]
- Mouse Orthologue:
- Atr
- Mouse Description:
- ataxia telangiectasia and Rad3 related Gene [Source:MGI Symbol;Acc:MGI:108028]
Alleles
There are 9 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa39800 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa19711 | Nonsense | Available for shipment | Available now |
sa6829 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa14005 | Nonsense | Available for shipment | Available now |
sa32870 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa15319 | Essential Splice Site | Available for shipment | Available now |
sa32869 | Essential Splice Site | Available for shipment | Available now |
sa38321 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa14645 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa39800
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000111604 | Essential Splice Site | 52 | 2651 | 2 | 48 |
ENSDART00000144801 | None | 2064 | None | 40 | |
ENSDART00000144988 | Essential Splice Site | 50 | 391 | 2 | 4 |
The following transcripts of ENSDARG00000079625 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 2 (position 16269691)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 16780518 GRCz11 2 16449108 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAGATACTTTGTCAGTTCATTGACAGGATATTGACAGATGTTGATGTCGG[T/A]AAGAAACAATAAACTGTATTTTGGGGTTTGTTGAGAATAGTTGTTCTTAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa19711
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000111604 | Nonsense | 106 | 2651 | 4 | 48 |
ENSDART00000144801 | None | 2064 | None | 40 | |
ENSDART00000144988 | Nonsense | 104 | 391 | 4 | 4 |
The following transcripts of ENSDARG00000079625 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 2 (position 16265705)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 16776532 GRCz11 2 16445122 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTATAACCATCATAGATTGACCGTCTACTTCTCCCTTCCCAGATTTCACT[A/T]AATGGATCATTAATCGCCTCTTACGAATTGCTGCTTGCCCAGAATGTGAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa6829
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000111604 | Nonsense | 270 | 2651 | 4 | 48 |
ENSDART00000144801 | None | 2064 | None | 40 | |
ENSDART00000144988 | Nonsense | 268 | 391 | 4 | 4 |
The following transcripts of ENSDARG00000079625 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 2 (position 16265213)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 16776040 GRCz11 2 16444630 - KASP Assay ID:
- 554-4624.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGCTTTTAACTCGSATTGTGACTCTAGGAGGCTTCCCCGAAGACCATTCA[C/T]AGCCCTTTTTCTCAGCTTTTTTGCATGTCCTGGACTCATTACCTGCTTTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa14005
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000111604 | Nonsense | 475 | 2651 | 6 | 48 |
ENSDART00000144801 | None | 2064 | None | 40 | |
ENSDART00000144988 | None | 391 | None | 4 |
The following transcripts of ENSDARG00000079625 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 2 (position 16263339)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 16774166 GRCz11 2 16442756 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GAAGAGCAGAAGTGAGGTTTGGGCAGCTGTAGACTGTCGTCTGGAGGAGT[T/A]ACTGWCACAGATGAGAAACCATACAGTGAGCCAATGCGTGAGTGCGGTTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa32870
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000111604 | Nonsense | 1279 | 2651 | 21 | 48 |
ENSDART00000144801 | Nonsense | 692 | 2064 | 13 | 40 |
ENSDART00000144988 | None | 391 | None | 4 |
The following transcripts of ENSDARG00000079625 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 2 (position 16240404)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 16751231 GRCz11 2 16419821 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTTCCTGACCATCCAGAACTGAAAATCATTCACAAAGTCCTTCAGGATTA[T/A]CGTAAGGTACAACCTAAACAAACCAAATGAAGCATAACAAACGACTTAAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa15319
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000111604 | Essential Splice Site | 1509 | 2651 | 26 | 48 |
ENSDART00000144801 | Essential Splice Site | 922 | 2064 | 18 | 40 |
ENSDART00000144988 | None | 391 | None | 4 |
The following transcripts of ENSDARG00000079625 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 2 (position 16234522)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 16745349 GRCz11 2 16413939 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CAAGTTCTCWGACTGGTCTGCAACATGGGYCGGATATCTCATCAGTAAAG[T/C]AAGTGCAAATYCTCACRTTTTCCTGGAGTCTCATATAWACAGAAAAAGCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa32869
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000111604 | Essential Splice Site | 1682 | 2651 | 29 | 48 |
ENSDART00000144801 | Essential Splice Site | 1097 | 2064 | 21 | 40 |
ENSDART00000144988 | None | 391 | None | 4 |
The following transcripts of ENSDARG00000079625 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 2 (position 16230941)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 16741768 GRCz11 2 16410358 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTATCCGGGAGAAGAAGCAGAACATCCAGGACCATCTTTCATTCCTACAG[G/A]TCTTACCACTCCACAGCTTTAAAAAAAAAAAACCTGTTTCATGTACAATA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa38321
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000111604 | Essential Splice Site | 2036 | 2651 | 36 | 48 |
ENSDART00000144801 | Essential Splice Site | 1449 | 2064 | 28 | 40 |
ENSDART00000144988 | None | 391 | None | 4 |
The following transcripts of ENSDARG00000079625 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 2 (position 16221384)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 16732211 GRCz11 2 16400801 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGAGGAGACAGCCAACTTCGAGAGCAATGCGATTATGAAAACCTATAAGG[T/A]ATTTCAGTTAGTCACAAATGAAGTCAAATGTCAGTACTGGAGTCAGATTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa14645
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000111604 | Essential Splice Site | 2594 | 2651 | 47 | 48 |
ENSDART00000144801 | Essential Splice Site | 2007 | 2064 | 39 | 40 |
ENSDART00000144988 | None | 391 | None | 4 |
The following transcripts of ENSDARG00000079625 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 2 (position 16208501)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 16719328 GRCz11 2 16387918 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GTTTCTCAAAGACTCAAGTCAATGAATCTGGAGAGATCCTCAATGARAAG[G/A]TACTTCATCYGTTAATTGCTCAAGGCTGARTGAGGRTCCTTATSTGTRAT
- Associated Phenotype:
- Not determined
OMIM
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: