si:dkey-91d10.8

Ensembl ID:
ENSDARG00000079616
ZFIN ID:
ZDB-GENE-030131-8255
Human Orthologue:
CRAMP1L
Human Description:
Crm, cramped-like (Drosophila) [Source:HGNC Symbol;Acc:14122]
Mouse Orthologue:
Cramp1l
Mouse Description:
Crm, cramped-like (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1930190]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12928 Nonsense Available for shipment Available now
sa19969 Nonsense Available for shipment Available now
sa40024 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa12928
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113630 Nonsense 64 1125 1 22
ENSDART00000148363 Nonsense 81 992 2 20
Genomic Location (Zv9):
Chromosome 3 (position 15493219)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 15738820
GRCz11 3 15888620
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAATCCATCCAGCACGGCCAGCCCCGGTTCGGCTCCCACTCCTTCCACA[C/T]AAACGTCAAGCCCACCCGGACCACARGTRAACCCGACAGCTCTTTCTCYG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19969
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113630 Nonsense 238 1125 5 22
ENSDART00000148363 Nonsense 271 992 5 20
Genomic Location (Zv9):
Chromosome 3 (position 15487558)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 15733159
GRCz11 3 15882959
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTGTTCGTCTTTCTCAGTGTATTCACGTGTGCTGAAAAAGTCCTCTCAG[G/T]AGCTCTATGGCCTCATCTGTTATGCTGAACTCAGGAAGAAGGTTGGAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40024
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113630 Essential Splice Site 997 1125 19 22
ENSDART00000148363 Essential Splice Site 856 992 17 20
Genomic Location (Zv9):
Chromosome 3 (position 15472159)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 15717760
GRCz11 3 15867560
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCAAATTAGCGACTCCATTATTGAGCTCGCCATCAACTCGCACTATGG[T/C]ATGACTTGTGTGACTGTTTTGCTTTATGGCTCATTCGACTGAATGGTTAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link