
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ENSDARG00000079603
- Ensembl ID:
- ENSDARG00000079603
- Human Orthologues:
- HTR3A, HTR3B, HTR3C, HTR3D, HTR3E, ZACN
- Human Descriptions:
- 5-hydroxytryptamine (serotonin) receptor 3 family member D [Source:HGNC Symbol;Acc:24004]
- 5-hydroxytryptamine (serotonin) receptor 3, family member C [Source:HGNC Symbol;Acc:24003]
- 5-hydroxytryptamine (serotonin) receptor 3, family member E [Source:HGNC Symbol;Acc:24005]
- 5-hydroxytryptamine (serotonin) receptor 3A [Source:HGNC Symbol;Acc:5297]
- 5-hydroxytryptamine (serotonin) receptor 3B [Source:HGNC Symbol;Acc:5298]
- zinc activated ligand-gated ion channel [Source:HGNC Symbol;Acc:29504]
- Mouse Orthologues:
- Htr3a, Htr3b
- Mouse Descriptions:
- 5-hydroxytryptamine (serotonin) receptor 3A Gene [Source:MGI Symbol;Acc:MGI:96282]
- 5-hydroxytryptamine (serotonin) receptor 3B Gene [Source:MGI Symbol;Acc:MGI:1861899]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa33333 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa33333
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000109636 | Nonsense | 171 | 242 | 6 | 6 |
- Genomic Location (Zv9):
- Chromosome 3 (position 58974879)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 58036554 GRCz11 3 58107078 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TATATATTTTTTTCTGTTTACATGCCAGATCACCATCAAGAGGAGACCTT[T/A]GCTGTATGTTATCAACATTATCATACCTGTGTTCTTCTTCATTGTGCTGG
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Major depressive disorder: A mega-analysis of genome-wide association studies for major depressive disorder. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
OMIM
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: