rbpms2

Ensembl ID:
ENSDARG00000079578
ZFIN ID:
ZDB-GENE-040426-741
Description:
RNA binding protein with multiple splicing 2 [Source:RefSeq peptide;Acc:NP_956553]
Human Orthologue:
RBPMS2
Human Description:
RNA binding protein with multiple splicing 2 [Source:HGNC Symbol;Acc:19098]
Mouse Orthologue:
Rbpms2
Mouse Description:
RNA binding protein with multiple splicing 2 Gene [Source:MGI Symbol;Acc:MGI:1919223]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9329 Essential Splice Site Mutation detected in F1 DNA During 2018
sa18890 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa9329
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006619 Essential Splice Site 57 200 None 8
ENSDART00000135671 Essential Splice Site 57 152 None 6
ENSDART00000142370 Essential Splice Site 57 179 None 7
ENSDART00000147968 Essential Splice Site 57 179 None 7
ENSDART00000148273   None 18 None 2
ENSDART00000006619 Essential Splice Site 57 200 None 8
ENSDART00000135671 Essential Splice Site 57 152 None 6
ENSDART00000142370 Essential Splice Site 57 179 None 7
ENSDART00000147968 Essential Splice Site 57 179 None 7
ENSDART00000148273   None 18 None 2

The following transcripts of ENSDARG00000079578 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 49716608)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 47986844
GRCz11 7 48259620
KASP Assay ID:
554-6153.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTTTTCAGGGTTATGAGGGTTCACTYATCAAGCTAACTTCAAAGCAGG[T/A]GAGACATTGTTAGACATTACAGCTGACCGGAWCTGCTATAAATMYAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18890
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006619 Essential Splice Site 57 200 None 8
ENSDART00000135671 Essential Splice Site 57 152 None 6
ENSDART00000142370 Essential Splice Site 57 179 None 7
ENSDART00000147968 Essential Splice Site 57 179 None 7
ENSDART00000148273   None 18 None 2
ENSDART00000006619 Essential Splice Site 57 200 None 8
ENSDART00000135671 Essential Splice Site 57 152 None 6
ENSDART00000142370 Essential Splice Site 57 179 None 7
ENSDART00000147968 Essential Splice Site 57 179 None 7
ENSDART00000148273   None 18 None 2

The following transcripts of ENSDARG00000079578 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 49716608)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 47986844
GRCz11 7 48259620
KASP Assay ID:
554-6153.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTTTTCAGGGTTATGAGGGTTCACTTATCAAGCTAACTTCAAAGCAGG[T/A]GAGACATTGTTAGACATTACAGCTGACCGGATCTGCTATAAATATAAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link