
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
rbpms2
- Ensembl ID:
- ENSDARG00000079578
- ZFIN ID:
- ZDB-GENE-040426-741
- Description:
- RNA binding protein with multiple splicing 2 [Source:RefSeq peptide;Acc:NP_956553]
- Human Orthologue:
- RBPMS2
- Human Description:
- RNA binding protein with multiple splicing 2 [Source:HGNC Symbol;Acc:19098]
- Mouse Orthologue:
- Rbpms2
- Mouse Description:
- RNA binding protein with multiple splicing 2 Gene [Source:MGI Symbol;Acc:MGI:1919223]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa9329 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa18890 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa9329
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000006619 | Essential Splice Site | 57 | 200 | None | 8 |
ENSDART00000135671 | Essential Splice Site | 57 | 152 | None | 6 |
ENSDART00000142370 | Essential Splice Site | 57 | 179 | None | 7 |
ENSDART00000147968 | Essential Splice Site | 57 | 179 | None | 7 |
ENSDART00000148273 | None | 18 | None | 2 | |
ENSDART00000006619 | Essential Splice Site | 57 | 200 | None | 8 |
ENSDART00000135671 | Essential Splice Site | 57 | 152 | None | 6 |
ENSDART00000142370 | Essential Splice Site | 57 | 179 | None | 7 |
ENSDART00000147968 | Essential Splice Site | 57 | 179 | None | 7 |
ENSDART00000148273 | None | 18 | None | 2 |
The following transcripts of ENSDARG00000079578 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 7 (position 49716608)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 47986844 GRCz11 7 48259620 - KASP Assay ID:
- 554-6153.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TCCTTTTCAGGGTTATGAGGGTTCACTYATCAAGCTAACTTCAAAGCAGG[T/A]GAGACATTGTTAGACATTACAGCTGACCGGAWCTGCTATAAATMYAAAAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa18890
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000006619 | Essential Splice Site | 57 | 200 | None | 8 |
ENSDART00000135671 | Essential Splice Site | 57 | 152 | None | 6 |
ENSDART00000142370 | Essential Splice Site | 57 | 179 | None | 7 |
ENSDART00000147968 | Essential Splice Site | 57 | 179 | None | 7 |
ENSDART00000148273 | None | 18 | None | 2 | |
ENSDART00000006619 | Essential Splice Site | 57 | 200 | None | 8 |
ENSDART00000135671 | Essential Splice Site | 57 | 152 | None | 6 |
ENSDART00000142370 | Essential Splice Site | 57 | 179 | None | 7 |
ENSDART00000147968 | Essential Splice Site | 57 | 179 | None | 7 |
ENSDART00000148273 | None | 18 | None | 2 |
The following transcripts of ENSDARG00000079578 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 7 (position 49716608)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 47986844 GRCz11 7 48259620 - KASP Assay ID:
- 554-6153.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCCTTTTCAGGGTTATGAGGGTTCACTTATCAAGCTAACTTCAAAGCAGG[T/A]GAGACATTGTTAGACATTACAGCTGACCGGATCTGCTATAAATATAAAAA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: