si:dkeyp-94b4.3

Ensembl ID:
ENSDARG00000079572
ZFIN IDs:
ZDB-GENE-081031-64, ZDB-GENE-081222-2, ZDB-GENE-081222-2, ZDB-GENE-081222-2
Description:
Novel protein similar to H.sapiens phospholipase C, delta [Source:UniProtKB/TrEMBL;Acc:B8JIR0]
Human Orthologue:
PLCD3
Human Description:
phospholipase C, delta 3 [Source:HGNC Symbol;Acc:9061]
Mouse Orthologue:
Plcd3
Mouse Description:
phospholipase C, delta 3 Gene [Source:MGI Symbol;Acc:MGI:107451]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31867 Essential Splice Site Available for shipment Available now
sa22061 Essential Splice Site Available for shipment Available now
sa24906 Nonsense Mutation detected in F1 DNA During 2018
sa22062 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31867
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079784 Essential Splice Site 275 769 5 15
ENSDART00000135143 Essential Splice Site 120 244 2 5
ENSDART00000145612   None 287 None 6
ENSDART00000079784 Essential Splice Site 275 769 5 15
ENSDART00000135143 Essential Splice Site 120 244 2 5
ENSDART00000145612   None 287 None 6
Genomic Location (Zv9):
Chromosome 12 (position 16483774)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 15594739
GRCz11 12 15637046
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTGTACATGCGCAGAGCCTCATCCTCACCTATGAGCTCAATGAATGGGG[T/A]ATCTTCTATTCACTTTTTGTGTTTTTTTGTATACACAATTCTTGGTAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22061
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079784 Essential Splice Site 275 769 5 15
ENSDART00000135143 Essential Splice Site 120 244 2 5
ENSDART00000145612   None 287 None 6
ENSDART00000079784 Essential Splice Site 275 769 5 15
ENSDART00000135143 Essential Splice Site 120 244 2 5
ENSDART00000145612   None 287 None 6
Genomic Location (Zv9):
Chromosome 12 (position 16483774)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 15594739
GRCz11 12 15637046
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTGTACATGCGCAGAGCCTCATCCTCACCTATGAGCTCAATGAATGGGG[T/A]ATCTTCTATTCACTTTTTGTGTTTTTTTGTATACACAATTCTTGGTAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24906
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079784 Nonsense 486 769 10 15
ENSDART00000135143   None 244 None 5
ENSDART00000145612 Nonsense 4 287 1 6
Genomic Location (Zv9):
Chromosome 12 (position 16505110)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 15616075
GRCz11 12 15658382
KASP Assay ID:
554-7288.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTTTTTTTTTTTTTTTTCCTTTTACATTTCCTCAGAGAGACTGTAAGT[T/A]GAGTTCTGAACTGTCTGATCTGGTGGTTTATACCTCCAGTGTTGCCTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22062
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079784 Nonsense 586 769 12 15
ENSDART00000135143   None 244 None 5
ENSDART00000145612 Nonsense 104 287 3 6
Genomic Location (Zv9):
Chromosome 12 (position 16505854)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 15616819
GRCz11 12 15659126
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCAGTGGCACTGAACTTCCAAACCCAATCTGAAGAGATGGATCTGAAC[A/T]GAGGCCGTTTCTTAGCAAACGGAAATTGCGGCTATGTGCTAAAACCAAGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link