vmhc

Ensembl ID:
ENSDARG00000079564
ZFIN ID:
ZDB-GENE-991123-5
Description:
ventricular myosin heavy chain [Source:RefSeq peptide;Acc:NP_001106204]
Human Orthologues:
MYH6, MYH7
Human Descriptions:
myosin, heavy chain 6, cardiac muscle, alpha [Source:HGNC Symbol;Acc:7576]
myosin, heavy chain 7, cardiac muscle, beta [Source:HGNC Symbol;Acc:7577]
Mouse Orthologues:
Myh6, Myh7
Mouse Descriptions:
myosin, heavy polypeptide 6, cardiac muscle, alpha Gene [Source:MGI Symbol;Acc:MGI:97255]
myosin, heavy polypeptide 7, cardiac muscle, beta Gene [Source:MGI Symbol;Acc:MGI:2155600]

Alleles

There are 20 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32911 Essential Splice Site Mutation detected in F1 DNA During 2018
sa18727 Nonsense Mutation detected in F1 DNA During 2018
sa10407 Nonsense Available for shipment Available now
sa19750 Essential Splice Site Available for shipment Available now
sa19751 Nonsense Available for shipment Available now
sa11779 Nonsense Available for shipment Available now
sa7497 Missense Mutation detected in F1 DNA During 2018
sa18019 Nonsense Available for shipment Available now
sa15964 Nonsense Available for shipment Available now
sa25806 Nonsense Mutation detected in F1 DNA During 2018
sa25807 Nonsense Mutation detected in F1 DNA During 2018
sa19752 Nonsense Available for shipment Available now
sa19753 Splice Site, Nonsense Available for shipment Available now
sa5139 Splice Site, Nonsense F2 line generated During 2018
sa32912 Nonsense Mutation detected in F1 DNA During 2018
sa32913 Nonsense Mutation detected in F1 DNA During 2018
sa2053 Nonsense F2 line generated During 2018
sa5718 Nonsense F2 line generated During 2018
sa10912 Nonsense Available for shipment Available now
sa18728 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa32911
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099532 Essential Splice Site None 1938 2 39
Genomic Location (Zv9):
Chromosome 2 (position 23594437)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24614058
GRCz11 2 24269709
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAGCATCAATTGATTTTTAGTGACAGATAATTATTATTATTTTTTTAAC[A/C]GGTTCTTCTGCCTCCGCACTTGGTGCACATCAGGTATAAATCACACTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18727
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099532 Nonsense 27 1938 3 39
ENSDART00000099532 Nonsense 27 1938 3 39
Genomic Location (Zv9):
Chromosome 2 (position 23594686)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24613809
GRCz11 2 24269460
KASP Assay ID:
2259-1970.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCAGCAGCTTCTTACCTGCGAAAGTCAGATCGAGAGCGTCTGGAAGCA[C/T]AAACCCGTCCCTTTGATATGAAAAAGGAGTGTTTTGTGCCTGATCCAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10407
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099532 Nonsense 27 1938 3 39
ENSDART00000099532 Nonsense 27 1938 3 39
Genomic Location (Zv9):
Chromosome 2 (position 23594686)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24613809
GRCz11 2 24269460
KASP Assay ID:
2259-1970.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGCAGCAGCTTCTTACCTGCGAAAGTCAGATCGAGAGCGTCTGGAAGCA[C/T]AAACCCGTCCCTTTGATATGAAAAAGGAGTGTTTTGTGCCTGAWCCAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19750
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099532 Essential Splice Site 68 1938 4 39
Genomic Location (Zv9):
Chromosome 2 (position 23595407)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24613088
GRCz11 2 24268739
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTACTTTAAAGTGTTATTTTAATAATTACAATCTTTCTGTTTTTCTCCC[A/T]GACTGTAACTGTAAAGGAAGCTGACATTCACCCCCAGAACCCTCCAAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19751
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099532 Nonsense 145 1938 5 39
Genomic Location (Zv9):
Chromosome 2 (position 23595724)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24612771
GRCz11 2 24268422
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAAGTGGCTGCCGGTGTACAATCAGGAGGTGGTTGTAGCCTATAGAGGG[A/T]AAAAGAGGAGTGAAGCTCCTCCCCACATCTTTTCCATCTCTGATAACGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11779
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099532 Nonsense 307 1938 11 39
Genomic Location (Zv9):
Chromosome 2 (position 23597598)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24610897
GRCz11 2 24266548
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATTTTTTCCCCTTGAAAYAGAGATGCTGCTCATCACCAACAACCCCTA[T/G]GACTACGCTTACATCTCCCAAGGAGAAACAACCGTAGCTTCAATTAAWGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7497
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099532 Missense 596 1938 16 39
Genomic Location (Zv9):
Chromosome 2 (position 23598926)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24609569
GRCz11 2 24265220
KASP Assay ID:
554-4055.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCACTATGCTGGTACAGTTGACTATAATATCAACAACTGGCTGGTGAAGA[A/G]CAAAGACCCATTRAATGAGACTGTGGTGGGACTCTTTCAAAAGTCTACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18019
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099532 Nonsense 942 1938 22 39
Genomic Location (Zv9):
Chromosome 2 (position 23600534)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24607961
GRCz11 2 24263612
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGAGCGACTTGAGGATGAGGAGSAGATGAATGCAGAGCTGAMAGCTAAG[A/T]AGAGAAAGCTGGAGGACGAATGCTCTGAGCTGMAGWAGGATATTGMTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15964
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099532 Nonsense 954 1938 22 39
Genomic Location (Zv9):
Chromosome 2 (position 23600570)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24607925
GRCz11 2 24263576
KASP Assay ID:
2259-1975.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTGAMAGCTAAGWAGAGAAAGCTGGAGGACGAATGCTCTGAGCTGMAG[A/T]AGGATATTGMTGATCTGGAGCTCACTCTGGCTAAAGTCGAGAAAGAGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25806
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099532 Nonsense 1169 1938 26 39
Genomic Location (Zv9):
Chromosome 2 (position 23601868)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24606627
GRCz10 2 24623763
GRCz11 2 24262278
GRCz11 2 24279414
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAGGAGGCTGGAGGAGCTACAGCTGCTCAGATTGAGATGAATAAGAAA[C/T]GAGAGGCAGAGTTTCAGAAGCTCCGCAGAGACCTTGAAGAGGCCACTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25807
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099532 Nonsense 1174 1938 26 39
Genomic Location (Zv9):
Chromosome 2 (position 23601883)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24606612
GRCz10 2 24623748
GRCz11 2 24262263
GRCz11 2 24279399
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCTACAGCTGCTCAGATTGAGATGAATAAGAAACGAGAGGCAGAGTTT[C/T]AGAAGCTCCGCAGAGACCTTGAAGAGGCCACTCTGCAGCATGAGGCCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19752
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099532 Nonsense 1225 1938 26 39
Genomic Location (Zv9):
Chromosome 2 (position 23602036)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24606459
GRCz11 2 24262110
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATAGACAATCTGCAGAGGGTCAAGCAAAAACTGGAGAAGGAGAAAAGT[G/T]AACTTAGGCTGGAGTTGGATGATGTAGTCTCAAACATGGAACATGTTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19753
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099532 Splice Site, Nonsense 1392 1938 29 39
Genomic Location (Zv9):
Chromosome 2 (position 23602792)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24605703
GRCz11 2 24261354
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAAGTACGAAACTGATGCCATCCAGAGAACTGAAGAACTGGAGGAAGCC[A/T]AGTAAGATCTGTTTCTATAAAATATTTCATACAAATTCTTCTTTAAGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5139
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099532 Splice Site, Nonsense 1393 1938 30 39
Genomic Location (Zv9):
Chromosome 2 (position 23603043)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24605452
GRCz11 2 24261103
KASP Assay ID:
554-3543.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACTAAAAAAGTATCTTNCCCAAAAATCTTCTTTWATTTTCTATAACAGA[A/T]AGAAACTGGCTCAACGCTTACAGGAAACCGAAGAAGCTGTTGAAGCAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32912
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099532 Nonsense 1592 1938 33 39
Genomic Location (Zv9):
Chromosome 2 (position 23604844)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24603651
GRCz11 2 24259302
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGCAAACTAGCCGAGAAGGATGAAGAGATGGAGCAGAGCAAACGCAATT[T/A]GCAGAGGACCATTGACACTCTGCAAAGCTCCTTGGAGTCAGAAACCAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32913
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099532 Nonsense 1619 1938 33 39
Genomic Location (Zv9):
Chromosome 2 (position 23604924)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24603571
GRCz11 2 24259222
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTTGGAGTCAGAAACCAGAAGCAGAAATGAGGCCCTCAGAATAAAAAAG[A/T]AGATGGAGGGCGACCTGAATGAGATGGAGATCCAGCTTAGTCAGGCAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2053
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099532 Nonsense 1691 1938 34 39
ENSDART00000099532 Nonsense 1691 1938 34 39
Genomic Location (Zv9):
Chromosome 2 (position 23605218)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24603277
GRCz11 2 24258928
KASP Assay ID:
554-3047.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATTGTAGAGAGACGCAACAACCTTCTGCAGGCTGAACTAGAGGAACTC[A/T]GAGCAGCTCTTGAGCAAACCGAAAGAGGCCGTAAGCTTGCTGAGCAGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5718
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099532 Nonsense 1691 1938 34 39
ENSDART00000099532 Nonsense 1691 1938 34 39
Genomic Location (Zv9):
Chromosome 2 (position 23605218)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24603277
GRCz11 2 24258928
KASP Assay ID:
554-3047.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATTGTAGAGAGACGCAACAACCTTCTGCAGGCTGAACTAGAGGAACTC[A/T]GAGCAGCTCTTGAGCAAACCGAAAGAGGCCGTAAGCTTGCTGAGCAGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10912
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099532 Nonsense 1918 1938 38 39
ENSDART00000099532 Nonsense 1918 1938 38 39
Genomic Location (Zv9):
Chromosome 2 (position 23606440)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24602055
GRCz11 2 24257706
KASP Assay ID:
2259-1982.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCAGCATGAGCTWGATGAGGCAGAAGAAAGAGCTGACATTGCAGAGTCA[C/T]AAGTCAATAAGCTACGTGCCAAAAGTCGTGATGTCAGTTCTAAGGTCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18728
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099532 Nonsense 1918 1938 38 39
ENSDART00000099532 Nonsense 1918 1938 38 39
Genomic Location (Zv9):
Chromosome 2 (position 23606440)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24602055
GRCz11 2 24257706
KASP Assay ID:
2259-1982.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCAGCATGAGCTTGATGAGGCAGAAGAAAGAGCTGACATTGCAGAGTCA[C/T]AAGTCAATAAGCTACGTGCCAAAAGTCGTGATGTCAGTTCTAAGGTCAGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link