si:dkey-276i5.4

Ensembl ID:
ENSDARG00000079547
ZFIN ID:
ZDB-GENE-091118-34
Human Orthologue:
ZBTB47
Human Description:
zinc finger and BTB domain containing 47 [Source:HGNC Symbol;Acc:26955]
Mouse Orthologue:
Zfp651
Mouse Description:
zinc finger protein 651 Gene [Source:MGI Symbol;Acc:MGI:2670992]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24484 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24484
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080501 Nonsense 149 639 1 5
ENSDART00000141823   None 269 None 5
Genomic Location (Zv9):
Chromosome 24 (position 21208781)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20455910
GRCz11 24 20600329
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGATAGAAGAGAGTGAAGGGGGAGTGGCTAGTTCAGGAGGGCGTGGTT[T/A]GTGTACAATGGAGGGTGGGGCCAATCCTAATAAAGCAGAATCACTGGATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link