
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:dkeyp-5f12.1
- Ensembl ID:
- ENSDARG00000079542
- ZFIN ID:
- ZDB-GENE-091116-18
- Human Orthologue:
- STARD13
- Human Description:
- StAR-related lipid transfer (START) domain containing 13 [Source:HGNC Symbol;Acc:19164]
- Mouse Orthologue:
- Stard13
- Mouse Description:
- StAR-related lipid transfer (START) domain containing 13 Gene [Source:MGI Symbol;Acc:MGI:2385331]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa11032 | Splice Site, Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa11032
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Splice Site, Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000110121 | Splice Site, Nonsense | 615 | 1098 | 7 | 14 |
ENSDART00000135303 | Splice Site, Nonsense | 634 | 1117 | 8 | 15 |
- Genomic Location (Zv9):
- Chromosome 10 (position 35411584)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 34439845 GRCz11 10 34383705 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGTATTATACAATTATGATTATAAACTAATCTCCTCRTTTGTGTTCTTAG[G/A]TCAGTGCCAAAATTCATGAAGAGAATAAAGGGACCAGACTACAAGGATAA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Intracranial aneurysm: Genome-wide association study of intracranial aneurysm identifies three new risk loci. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: