si:dkeyp-5f12.1

Ensembl ID:
ENSDARG00000079542
ZFIN ID:
ZDB-GENE-091116-18
Human Orthologue:
STARD13
Human Description:
StAR-related lipid transfer (START) domain containing 13 [Source:HGNC Symbol;Acc:19164]
Mouse Orthologue:
Stard13
Mouse Description:
StAR-related lipid transfer (START) domain containing 13 Gene [Source:MGI Symbol;Acc:MGI:2385331]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11032 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11032
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110121 Splice Site, Nonsense 615 1098 7 14
ENSDART00000135303 Splice Site, Nonsense 634 1117 8 15
Genomic Location (Zv9):
Chromosome 10 (position 35411584)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 34439845
GRCz11 10 34383705
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTATTATACAATTATGATTATAAACTAATCTCCTCRTTTGTGTTCTTAG[G/A]TCAGTGCCAAAATTCATGAAGAGAATAAAGGGACCAGACTACAAGGATAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link