zgc:163077

Ensembl ID:
ENSDARG00000079539
ZFIN ID:
ZDB-GENE-070521-6
Description:
Zgc:163077 protein [Source:UniProtKB/TrEMBL;Acc:A4VCH2]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32324 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32324
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056850 Nonsense 147 301 2 2
ENSDART00000147123 Nonsense 147 301 3 3
Genomic Location (Zv9):
Chromosome 21 (position 2726259)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 2146476
GRCz11 21 2172300
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTTCACATGCACGGAGTGTGGGAAGAGTTTCAAACATAAAAACAGTCTA[C/T]AACATCACCAGCTCACTCACTCTGGAGTAAAGCCATTCAGCTGTGATCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link