LOC100332466

Ensembl ID:
ENSDARG00000079534

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45423 Nonsense Mutation detected in F1 DNA During 2018
sa7346 Missense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45423
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113468 Nonsense 152 424 3 6
Genomic Location (Zv9):
Chromosome 11 (position 18656229)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18081260
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACGCAGGGATGTTTCTCTTGTTGCTCCGTACACTGGCTGTAACGTCAGA[C/T]AACAGGTTAGTGTGAATATTATCTGACAGGTTCGTCTCCAATCATAAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7346
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113468 Missense 257 424 6 6
Genomic Location (Zv9):
Chromosome 11 (position 18655700)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18080731
GRCz11 11 18195745
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCCTCAGGAMACAKACTGGAACTTGMCTTTGCTGTTGGGRGACMGAGAA[G/A]TGGTTCTTTCCTGCCYRAAGCCWACAGAATCAACACCGACCGTTSCCCCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link