si:dkey-31k9.2

Ensembl ID:
ENSDARG00000079528
ZFIN ID:
ZDB-GENE-070912-512
Description:
Novel protein similar to vertebrate human immunodeficiency virus type I enhancer binding protein 1 (
Human Orthologue:
HIVEP1
Human Description:
human immunodeficiency virus type I enhancer binding protein 1 [Source:HGNC Symbol;Acc:4920]
Mouse Orthologue:
Hivep1
Mouse Description:
human immunodeficiency virus type I enhancer binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:96100

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18568 Nonsense Available for shipment Available now
sa13312 Nonsense Available for shipment Available now
sa17128 Nonsense Available for shipment Available now
sa43204 Splice Site Mutation detected in F1 DNA During 2018
sa9898 Nonsense Available for shipment Available now
sa18511 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18568
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110201 Nonsense 655 2621 2 7

The following transcripts of ENSDARG00000079528 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 3956962)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 3453535
GRCz11 19 3394433
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTGCCCARTTGTGGCAGCTGTCAKGCATGTAGCAACTATTGAAAAGCCT[C/T]GAGTTCCTTCAGGACAAATGCGTCCTCCATTGGAAACCAAAGCTCWATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13312
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110201 Nonsense 1511 2621 2 7

The following transcripts of ENSDARG00000079528 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 3954394)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 3450967
GRCz11 19 3391865
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATAACAATACCAATAGCTAATGAAATTAAAGGGTCACATTCAAATGAT[G/T]GAATGCAAAATGTCTATGTTGCACAATCAAGTTATCAGGCTGTACTCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17128
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110201 Nonsense 1788 2621 2 7

The following transcripts of ENSDARG00000079528 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 3953561)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 3450134
GRCz11 19 3391032
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAGAGAATTCCACTTTAAAGCCACAAGAGAAACCTGAGGAGCAGCGCTG[G/A]TCTCCATCAAAATCACCTCTGAGGCCTCCATCATTTCAGGGACAAGTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43204
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110201 Splice Site None 2621 None 7

The following transcripts of ENSDARG00000079528 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 3953070)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 3449643
GRCz11 19 3390541
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACGCTAGGATAAATAAACGATTAACAAATTCTTCTCACTTCTTTTATC[G/A]CTTCAGGTTTTGATACAGCAAAGATCTGTGCCAAGTGAGAATAGTGGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9898
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110201 Nonsense 2087 2621 6 7

The following transcripts of ENSDARG00000079528 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 3951190)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 3447763
GRCz11 19 3388661
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGACTCTGATGGCCCAGATGATGAAGATAATGAGGGAGAGGAGGAAGAT[G/T]AGGAGGACAGCCAGGCAGAGTCTGGCCTTTCTGCTACACCTTCYGTTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18511
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110201 Nonsense 2395 2621 7 7

The following transcripts of ENSDARG00000079528 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 3950001)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 3446574
GRCz11 19 3387472
KASP Assay ID:
2261-2806.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTGTTTCCCCCTTGGYCAAGTGGCAGGGCTTCARACACTTGGTGCTCAC[C/T]AGACCRCCCTGCAGCCTGTGGGTTTGGAGAYCTTGAGTGTTGTAGGTTTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link