slc39a5

Ensembl ID:
ENSDARG00000079525
ZFIN ID:
ZDB-GENE-060608-1
Human Orthologue:
SLC39A5
Human Description:
solute carrier family 39 (metal ion transporter), member 5 [Source:HGNC Symbol;Acc:20502]
Mouse Orthologue:
Slc39a5
Mouse Description:
solute carrier family 39 (metal ion transporter), member 5 Gene [Source:MGI Symbol;Acc:MGI:1919336]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29976 Nonsense Mutation detected in F1 DNA During 2018
sa12403 Nonsense Available for shipment Available now
sa44023 Splice Site, Nonsense Mutation detected in F1 DNA During 2018
sa37758 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa29976
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112788 Nonsense 158 610 3 12
Genomic Location (Zv9):
Chromosome 23 (position 32576210)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 32411100
GRCz11 23 32337631
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAGCTGCTTGGTAGTTTGGGTTTGGGAGAAGTCAGTGTCCTGGAGATT[C/T]GACATGGTGAAGCAAAACATCCTTCTCAATCGATATCCCATTCCCACTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12403
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112788 Nonsense 277 610 5 12
Genomic Location (Zv9):
Chromosome 23 (position 32579889)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 32414779
GRCz11 23 32341310
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCACTCCTGCCCACTTCACCTTCCTGTGCCCWGCCCTCCTRTACCAGATC[G/T]AGAGCGGAGTGTGTCTGCGGCACACNNNAGATCATTCACAGRCCAGCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44023
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112788 Splice Site, Nonsense 397 610 7 12
Genomic Location (Zv9):
Chromosome 23 (position 32585835)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 32420725
GRCz11 23 32347256
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTACCTTCTCTTCATCTTTGAGAGTCTTCTGGGACTTAAGCAGCATTTC[A/T]AGGTGAGCTTCAGCCAGTGCAAAACATGATGTTTTTGCTCAATTATTAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37758
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112788 Essential Splice Site 556 610 11 12
Genomic Location (Zv9):
Chromosome 23 (position 32586784)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 32421674
GRCz11 23 32348205
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTCACACTCACCGCCGGTGTCTTCCTCTATGTAGCTCTTGCTGACATG[G/T]TAATCATCTTAACTGTTCAAAACAAAGTTAAATGTAGTTGATAGTTGAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link